MLF2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52007-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MLF2 Reagents
CRO Services
Product recommended

All MLF2 Reagents
MLF2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
744 bp
Description
Full length Clone DNA of Mouse myeloid leukemia factor 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MLF2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AI256856 cDNA ORF Clone, Mouse;AU018944 cDNA ORF Clone, Mouse;C77284 cDNA ORF Clone, Mouse
MLF2 Background Information
Full Name
myeloid leukemia factor 2

MLF2 cDNA ORF Clone, Rhesus, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Rhesus CG90686-G
MLF2 cDNA ORF Clone, Rhesus, untagged CG90686-UT
MLF2 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90686-ACG
MLF2 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90686-ACGLN
MLF2 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90686-ANG
MLF2 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90686-ACR
MLF2 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90686-ANR
MLF2 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90686-CF
MLF2 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90686-NF
MLF2 cDNA ORF Clone, Rhesus, C-His tag CG90686-CH
MLF2 cDNA ORF Clone, Rhesus, N-His tag CG90686-NH
MLF2 cDNA ORF Clone, Rhesus, C-HA tag CG90686-CY
MLF2 cDNA ORF Clone, Rhesus, N-HA tag CG90686-NY
MLF2 cDNA ORF Clone, Rhesus, C-Myc tag CG90686-CM
MLF2 cDNA ORF Clone, Rhesus, N-Myc tag CG90686-NM

MLF2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Mouse MG52007-U
MLF2 cDNA ORF Clone, Mouse, untagged MG52007-UT
MLF2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52007-ACGLN
MLF2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52007-ACG
MLF2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52007-ANG
MLF2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52007-ACR
MLF2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52007-ANR
MLF2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52007-CF
MLF2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52007-NF
MLF2 cDNA ORF Clone, Mouse, C-His tag MG52007-CH
MLF2 cDNA ORF Clone, Mouse, C-HA tag MG52007-CY
MLF2 cDNA ORF Clone, Mouse, N-HA tag MG52007-NY
MLF2 cDNA ORF Clone, Mouse, C-Myc tag MG52007-CM
MLF2 cDNA ORF Clone, Mouse, N-Myc tag MG52007-NM
MLF2 qPCR Primer Pairs, Mouse MP201880

MLF2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MLF2 cDNA ORF Clone in Cloning Vector, Human HG16686-U
MLF2 cDNA ORF Clone, Human, untagged HG16686-UT
MLF2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16686-ACG
MLF2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16686-ACGLN
MLF2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16686-ANG
MLF2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16686-ACR
MLF2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16686-ANR
MLF2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16686-CF
MLF2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16686-NF
MLF2 cDNA ORF Clone, Human, C-His tag HG16686-CH
MLF2 cDNA ORF Clone, Human, N-His tag HG16686-NH
MLF2 cDNA ORF Clone, Human, C-HA tag HG16686-CY
MLF2 cDNA ORF Clone, Human, N-HA tag HG16686-NY
MLF2 cDNA ORF Clone, Human, C-Myc tag HG16686-CM
MLF2 cDNA ORF Clone, Human, N-Myc tag HG16686-NM
info info
添加购物车成功! 添加购物车失败!