Text Size:AAA

Mouse MFI2 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse MFI2 cDNA Clone Product Information
    NCBI RefSeq:NM_013900.2
    RefSeq ORF Size:2217bp
    cDNA Description:Full length Clone DNA of Mus musculus antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5.
    Gene Synonym:MTf, CD228, Mfi2
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MFI2 qPCR primers for gene expression analysis, MP200960 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    References
  • Richardson DR. (2000) The role of the membrane-bound tumour antigen, melanotransferrin (p97), in iron uptake by the human malignant melanoma cell. Eur J Biochem. 267(5): 1290-8.
  • Kim DK, et al. (2001) Serum melanotransferrin, p97 as a biochemical marker of Alzheimer's disease. Neuropsychopharmacology. 25(1): 84-90.
  • Rothenberger S, et al. (1996) Coincident expression and distribution of melanotransferrin and transferrin receptor in human brain capillary endothelium. Brain Res. 712(1): 117-21.
  • Baker EN, et al. (1992) Human melanotransferrin (p97) has only one functional iron-binding site. FEBS Lett. 298(2-3): 215-8.
  • Size / Price
    Catalog: MG50994-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"