Quick Order

Mouse MAP2 Gene ORF cDNA clone expression plasmid, C-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse METAP2 cDNA Clone Product Information
    NCBI RefSeq:NM_019648.3
    RefSeq ORF Size:1437bp
    cDNA Description:Full length Clone DNA of Mus musculus methionine aminopeptidase 2 with C terminal Myc tag.
    Gene Synonym:p67, Amp2, Mnpep, p67eIF2, AI047573, AL024412, AU014659, MGC102452, A930035J23Rik, Metap2
    Species:Mouse
    Vector:pCMV3-C-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with METAP2 qPCR primers for gene expression analysis, MP200520 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    METAP2 (Methionine aminopeptidase 2), also known as MAP2 is a a protein which belongs to the peptidase M24A family. MAP2 binds 2 cobalt or manganese ions and contains approximately 12 O-linked N-acetylglucosamine (GlcNAc) residues. It is found in all organisms and is especially important because of its critical role in tissue repair and protein degradation. The catalytic activity of human MAP2 toward Met-Val peptides is consistently two orders of magnitude higher than that of METAP1, suggesting that it is responsible for processing proteins containing N-terminal Met-Val and Met-Thr sequences in vivo. This protein functions both by protecting the alpha subunit of eukaryotic initiation factor 2 from inhibitory phosphorylation and by removing the amino-terminal methionine residue from nascent protein. MAP2 protects eukaryotic initiation factor EIF2S1 from translation-inhibiting phosphorylation by inhibitory kinases such as EIF2AK2/PKR and EIF2AK1/HCR. It also plays a critical role in the regulation of protein synthesis.

    References
  • Bennett, et al. (1997) EPR Studies on the Mono- and Dicobalt (II)-Substituted Forms of the Aminopeptidase from Aeromonas proteolytica. Insight into the Catalytic Mechanism of Dinuclear Hydrolases. J Am Chem Soc. 119:1923-33.
  • Johansson, et al. (2008) Dicobalt II-II, II-III, and III-III Complexes as Spectroscopic Models for Dicobalt Enzyme Active Sites. Inorg Chem. 47:5079-92.
  • Bradshaw, et al. (2002) Aminopeptidases and angiogenesis. Essays Biochem. 38: 5-78.
  • Size / Price
    Catalog: MG50528-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"