METAP1D cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50938-NM
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All METAP1D Reagents
CRO Services
Product recommended

All METAP1D Reagents
METAP1D cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Mouse methionyl aminopeptidase type 1D (mitochondrial) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

METAP1D cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
2310066F24Rik cDNA ORF Clone, Mouse;3110033D18Rik cDNA ORF Clone, Mouse;AV117938 cDNA ORF Clone, Mouse;MAP 1D cDNA ORF Clone, Mouse;Map1d cDNA ORF Clone, Mouse;MetAP 1D cDNA ORF Clone, Mouse;Metapl1 cDNA ORF Clone, Mouse
METAP1D Background Information

Methionine aminopeptidase 1D, also known as MAP1D, is a member of the peptidase M24A family. N-terminal methionine removal is an important cellular process required for proper biological activity, subcellular localization, and eventual degradation of many proteins. The enzymes that catalyze this reaction are called Methionine aminopeptidases (MAPs). MAP1D is overexpressed in colon cancer cell lines and colon tumors as compared to normal tissues (at protein level). Downregulation of MAP1D expression by shRNA in HCT-116 colon carcinoma cells reduces anchorage-independant growth in soft agar. MAP1D binds two cobalt ions per subunit. The true nature of the physiological cofactor is under debate. MAP1D is also active with zinc, manganese or divalent ions. MAP1D removes the amino-terminal methionine from nascent proteins. It may also play an important role in colon tumorigenesis.

Full Name
methionyl aminopeptidase type 1D (mitochondrial)
References
  • Serero A., et al.,(2003), An unusual peptide deformylase features in the human mitochondrial N-terminal methionine excision pathway. J. Biol. Chem. 278:52953-52963.
  • Leszczyniecka M., et al., (2006), MAP1D, a novel methionine aminopeptidase family member is overexpressed in colon cancer.Oncogene 25:3471-3478.
  • Vaca Jacome A.S., et al.,(2015), N-terminome analysis of the human mitochondrial proteome.Proteomics 15:2519-2524.
  • METAP1D cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    METAP1D cDNA ORF Clone in Cloning Vector, Mouse MG50938-G
    METAP1D cDNA ORF Clone, Mouse, untagged MG50938-UT
    METAP1D cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50938-ACG
    METAP1D Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50938-ACGLN
    METAP1D cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50938-ANG
    METAP1D cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50938-ACR
    METAP1D cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50938-ANR
    METAP1D cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50938-CF
    METAP1D cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50938-NF
    METAP1D cDNA ORF Clone, Mouse, C-His tag MG50938-CH
    METAP1D cDNA ORF Clone, Mouse, N-His tag MG50938-NH
    METAP1D cDNA ORF Clone, Mouse, C-HA tag MG50938-CY
    METAP1D cDNA ORF Clone, Mouse, N-HA tag MG50938-NY
    METAP1D cDNA ORF Clone, Mouse, C-Myc tag MG50938-CM
    METAP1D qPCR Primer Pairs, Mouse MP200907

    METAP1D cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    METAP1D cDNA ORF Clone in Cloning Vector, Human HG10883-M
    METAP1D cDNA ORF Clone, Human, untagged HG10883-UT
    METAP1D cDNA ORF Clone, Human, C-GFPSpark® tag HG10883-ACG
    METAP1D Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10883-ACGLN
    METAP1D cDNA ORF Clone, Human, N-GFPSpark® tag HG10883-ANG
    METAP1D cDNA ORF Clone, Human, C-OFPSpark® tag HG10883-ACR
    METAP1D cDNA ORF Clone, Human, N-OFPSpark® tag HG10883-ANR
    METAP1D cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10883-CF
    METAP1D cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10883-NF
    METAP1D cDNA ORF Clone, Human, C-His tag HG10883-CH
    METAP1D cDNA ORF Clone, Human, N-His tag HG10883-NH
    METAP1D cDNA ORF Clone, Human, C-HA tag HG10883-CY
    METAP1D cDNA ORF Clone, Human, N-HA tag HG10883-NY
    METAP1D cDNA ORF Clone, Human, C-Myc tag HG10883-CM
    METAP1D cDNA ORF Clone, Human, N-Myc tag HG10883-NM
    METAP1D qPCR Primer Pairs, Human HP100769
    info info
    添加购物车成功! 添加购物车失败!