After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse c-Met/Met/HGFR Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse MET cDNA Clone Product Information
NCBI RefSeq:NM_008591.2
RefSeq ORF Size:4140bp
cDNA Description:Full length Clone DNA of Mus musculus met proto-oncogene with C terminal Myc tag.
Gene Synonym:HGF, HGFR, Par4, c-Met, AI838057, Met
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.

References
  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.
  • Size / Price
    Catalog: MG50622-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"