MEST cDNA ORF Clone, Mouse, N-His tag

Cat: MG53063-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MEST Reagents
CRO Services
Product recommended

All MEST Reagents
MEST cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1008 bp
Description
Full length Clone DNA of Mouse mesoderm specific transcript with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MEST cDNA ORF Clone, Mouse, N-His tag Alternative Names
AA408879 cDNA ORF Clone, Mouse;AI256745 cDNA ORF Clone, Mouse;Peg1 cDNA ORF Clone, Mouse
MEST Background Information
Full Name
mesoderm specific transcript

MEST cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MEST cDNA ORF Clone in Cloning Vector, Rat RG8A4289-U
MEST Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A4289-ACGLN

MEST cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MEST cDNA ORF Clone in Cloning Vector, Mouse MG53063-G
MEST cDNA ORF Clone, Mouse, untagged MG53063-UT
MEST Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53063-ACGLN
MEST cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53063-ACG
MEST cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53063-ANG
MEST cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53063-ACR
MEST cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53063-ANR
MEST cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53063-CF
MEST cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG53063-NF
MEST cDNA ORF Clone, Mouse, C-His tag MG53063-CH
MEST cDNA ORF Clone, Mouse, C-HA tag MG53063-CY
MEST cDNA ORF Clone, Mouse, N-HA tag MG53063-NY
MEST cDNA ORF Clone, Mouse, C-Myc tag MG53063-CM
MEST cDNA ORF Clone, Mouse, N-Myc tag MG53063-NM

MEST cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MEST cDNA ORF Clone in Cloning Vector, Human HG16505-G
MEST cDNA ORF Clone, Human, untagged HG16505-UT
MEST Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16505-ACGLN
MEST cDNA ORF Clone, Human, C-GFPSpark® tag HG16505-ACG
MEST cDNA ORF Clone, Human, C-OFPSpark® tag HG16505-ACR
MEST cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16505-CF
MEST cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16505-NF
MEST cDNA ORF Clone, Human, C-His tag HG16505-CH
MEST cDNA ORF Clone, Human, N-His tag HG16505-NH
MEST cDNA ORF Clone, Human, C-HA tag HG16505-CY
MEST cDNA ORF Clone, Human, N-HA tag HG16505-NY
MEST cDNA ORF Clone, Human, C-Myc tag HG16505-CM
MEST cDNA ORF Clone, Human, N-Myc tag HG16505-NM
info info
添加购物车成功! 添加购物车失败!