Quick Order

Mouse MESDC2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse MESDC2 cDNA Clone Product Information
    NCBI RefSeq:NM_023403.2
    RefSeq ORF Size:674bp
    cDNA Description:Full length Clone DNA of Mus musculus mesoderm development candidate 2 with N terminal Myc tag.
    Gene Synonym:AW537813, MGC25959, mKIAA0081, 2210015O11Rik, Mesdc2
    Species:Mouse
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MESDC2 qPCR primers for gene expression analysis, MP200229 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    LDLR chaperone MESD, also known as Mesoderm development protein, Mesoderm development candidate 2, Renal carcinoma antigen NY-REN-61 and MESDC2, is a member of the MESD family. MESDC2 is a chaperone specifically assisting the folding of beta-propeller/EGF modules within the family of low-density lipoprotein receptors (LDLRs). The LDLR maturation activity resides in the N- and C-terminal unstructured regions. MESDC2 acts as a modulator of the Wnt pathway, since some LDLRs are coreceptors for the canonical Wnt pathway. MESDC2 is essential for specification of embryonic polarity and mesoderm induction.

    References
  • Scanlan M.J. et al., 1999, Int. J. Cancer 83:456-464.
  • Veltman,IM. et al.,2005, Hum Mol Genet  14 (14):1955-63.
  • Koduri V. et al., 2007, Biochemistry 46:6570-7.
  • Size / Price
    Catalog: MG50200-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"