Quick Order

Text Size:AAA

Mouse MERTK/Mer Gene ORF cDNA clone expression plasmid, C-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse MERTK cDNA Clone Product Information
NCBI RefSeq:NM_008587.1
RefSeq ORF Size:2985bp
cDNA Description:Full length Clone DNA of Mus musculus c-mer proto-oncogene tyrosine kinase with C terminal His tag.
Gene Synonym:Eyk, Mer, Nyk, Mertk
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

&Proto-oncogene tyrosine-protein kinase MER (MERTK) is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. MERTK is localized in membrane and is no expressed in normal B- and T-lymphocytes but is expressed in numerous neoplastic B- and T-cell lines. This protein is highly expressed in testis, ovary, prostate, lung, and kidney, with lower expression in spleen, small intestine, colon, and liver. MERTK regulates many physiological processes including cell survival, migration, differentiation, and phagocytosis of apoptotic cells (efferocytosis). Ligand binding at the cell surface induces autophosphorylation of MERTK on its intracellular domain that provides docking sites for downstream signaling molecules. MERTK signaling plays a role in various processes such as macrophage clearance of apoptotic cells, platelet aggregation, cytoskeleton reorganization and engulfment. MERTK plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. Defects in MERTK are the cause of retinitis pigmentosa type 38.

References
  • Thompson DA, et al. (2002) Retinal dystrophy due to paternal isodisomy for chromosome 1 or chromosome 2, with homoallelism for mutations in RPE65 or MERTK, respectively. Am J Hum Genet. 70 (1): 224-9.
  • Tada A, et al. (2006) Screening of the MERTK gene for mutations in Japanese patients with autosomal recessive retinitis pigmentosa. Mol Vis. 12: 441-4.
  • McHenry CL, et al. (2004) MERTK arginine-844-cysteine in a patient with severe rod-cone dystrophy: loss of mutant protein function in transfected cells. Invest Ophthalmol. Vis Sci. 45 (5): 1456-63.
  • Size / Price
    Catalog: MG50514-CH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"