Quick Order

Mouse MERTK ORF mammalian expression plasmid, C-Flag tag

DatasheetReviewsRelated ProductsProtocols
Mouse MERTK cDNA Clone Product Information
NCBI RefSeq:NM_008587.1
RefSeq ORF Size:2985bp
cDNA Description:Full length Clone DNA of Mus musculus c-mer proto-oncogene tyrosine kinase with C terminal Flag tag.
Gene Synonym:Eyk, Mer, Nyk, Mertk
Species:Mouse
Vector:pCMV3-C-FLAG
Plasmid:
Restriction Site:
Tag Sequence:FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
FLAG Tag Info

FLAG-tag, or FLAG octapeptide, is a polypeptide protein tag that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild-type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A FLAG-tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a FLAG-tag to this protein allows one to follow the protein with an antibody against the FLAG sequence. Examples are cellular localization studies by immunofluorescence or detection by SDS PAGE protein electrophoresis.

The peptide sequence of the FLAG-tag from the N-terminus to the C-terminus is: DYKDDDDK (1012 Da). It can be used in conjunction with other affinity tags, for example a polyhistidine tag (His-tag), HA-tag or Myc-tag. It can be fused to the C-terminus or the N-terminus of a protein. Some commercially available antibodies (e.g., M1/4E11) recognize the epitope only when it is present at the N-terminus. However, other available antibodies (e.g., M2) are position-insensitive.

Product nameProduct name
Background

&Proto-oncogene tyrosine-protein kinase MER (MERTK) is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. MERTK is localized in membrane and is no expressed in normal B- and T-lymphocytes but is expressed in numerous neoplastic B- and T-cell lines. This protein is highly expressed in testis, ovary, prostate, lung, and kidney, with lower expression in spleen, small intestine, colon, and liver. MERTK regulates many physiological processes including cell survival, migration, differentiation, and phagocytosis of apoptotic cells (efferocytosis). Ligand binding at the cell surface induces autophosphorylation of MERTK on its intracellular domain that provides docking sites for downstream signaling molecules. MERTK signaling plays a role in various processes such as macrophage clearance of apoptotic cells, platelet aggregation, cytoskeleton reorganization and engulfment. MERTK plays also an important role in inhibition of Toll-like receptors (TLRs)-mediated innate immune response by activating STAT1, which selectively induces production of suppressors of cytokine signaling SOCS1 and SOCS3. Defects in MERTK are the cause of retinitis pigmentosa type 38.

References
  • Thompson DA, et al. (2002) Retinal dystrophy due to paternal isodisomy for chromosome 1 or chromosome 2, with homoallelism for mutations in RPE65 or MERTK, respectively. Am J Hum Genet. 70 (1): 224-9.
  • Tada A, et al. (2006) Screening of the MERTK gene for mutations in Japanese patients with autosomal recessive retinitis pigmentosa. Mol Vis. 12: 441-4.
  • McHenry CL, et al. (2004) MERTK arginine-844-cysteine in a patient with severe rod-cone dystrophy: loss of mutant protein function in transfected cells. Invest Ophthalmol. Vis Sci. 45 (5): 1456-63.
  • Size / Price
    Catalog: MG50514-CF
    List Price:   (Save )
    Price:      [How to order]
    Availability
     Shipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"