MEN1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52635-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All MEN1 Reagents
CRO Services
Product recommended

All MEN1 Reagents
MEN1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1836 bp
Description
Full length Clone DNA of Mouse multiple endocrine neoplasia 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MEN1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW045611 cDNA ORF Clone, Mouse
MEN1 Background Information
Full Name
multiple endocrine neoplasia I

MEN1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MEN1 cDNA ORF Clone in Cloning Vector, Mouse MG52635-G
MEN1 cDNA ORF Clone, Mouse, untagged MG52635-UT
MEN1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52635-ACG
MEN1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52635-ACGLN
MEN1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52635-ANG
MEN1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52635-ACR
MEN1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52635-ANR
MEN1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52635-CF
MEN1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52635-NF
MEN1 cDNA ORF Clone, Mouse, C-His tag MG52635-CH
MEN1 cDNA ORF Clone, Mouse, C-HA tag MG52635-CY
MEN1 cDNA ORF Clone, Mouse, N-HA tag MG52635-NY
MEN1 cDNA ORF Clone, Mouse, C-Myc tag MG52635-CM
MEN1 cDNA ORF Clone, Mouse, N-Myc tag MG52635-NM
MEN1 qPCR Primer Pairs, Mouse MP202506

MEN1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MEN1 cDNA ORF Clone in Cloning Vector, Human HG12207-G
MEN1 cDNA ORF Clone, Human, untagged HG12207-UT
MEN1 cDNA ORF Clone, Human, C-GFPSpark® tag HG12207-ACG
MEN1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12207-ACGLN
MEN1 cDNA ORF Clone, Human, N-GFPSpark® tag HG12207-ANG
MEN1 cDNA ORF Clone, Human, C-OFPSpark® tag HG12207-ACR
MEN1 cDNA ORF Clone, Human, N-OFPSpark® tag HG12207-ANR
MEN1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12207-CF
MEN1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12207-NF
MEN1 cDNA ORF Clone, Human, C-His tag HG12207-CH
MEN1 cDNA ORF Clone, Human, N-His tag HG12207-NH
MEN1 cDNA ORF Clone, Human, C-HA tag HG12207-CY
MEN1 cDNA ORF Clone, Human, N-HA tag HG12207-NY
MEN1 cDNA ORF Clone, Human, C-Myc tag HG12207-CM
MEN1 cDNA ORF Clone, Human, N-Myc tag HG12207-NM
MEN1 qPCR Primer Pairs, Human HP101873
info info
添加购物车成功! 添加购物车失败!