MED22 cDNA ORF Clone, Mouse, untagged

Cat: MG52609-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MED22 Reagents
CRO Services
Product recommended

All MED22 Reagents
MED22 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
603 bp
Description
Full length Clone DNA of Mouse mediator complex subunit 22.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MED22 cDNA ORF Clone, Mouse, untagged Alternative Names
AW212655 cDNA ORF Clone, Mouse;AW558812 cDNA ORF Clone, Mouse;Surf-5 cDNA ORF Clone, Mouse;Surf5 cDNA ORF Clone, Mouse
MED22 Background Information
Full Name
mediator complex subunit 22

MED22 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MED22 cDNA ORF Clone in Cloning Vector, Mouse MG52609-G
MED22 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52609-ACGLN
MED22 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52609-ACG
MED22 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52609-ANG
MED22 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52609-ACR
MED22 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52609-ANR
MED22 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52609-CF
MED22 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52609-NF
MED22 cDNA ORF Clone, Mouse, C-His tag MG52609-CH
MED22 cDNA ORF Clone, Mouse, N-His tag MG52609-NH
MED22 cDNA ORF Clone, Mouse, C-HA tag MG52609-CY
MED22 cDNA ORF Clone, Mouse, N-HA tag MG52609-NY
MED22 cDNA ORF Clone, Mouse, C-Myc tag MG52609-CM
MED22 cDNA ORF Clone, Mouse, N-Myc tag MG52609-NM
MED22 qPCR Primer Pairs, Mouse MP202480

MED22 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MED22 cDNA ORF Clone in Cloning Vector, Human HG15146-G
MED22 cDNA ORF Clone, Human, untagged HG15146-UT
MED22 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15146-ACGLN
MED22 cDNA ORF Clone, Human, C-GFPSpark® tag HG15146-ACG
MED22 cDNA ORF Clone, Human, N-GFPSpark® tag HG15146-ANG
MED22 cDNA ORF Clone, Human, C-OFPSpark® tag HG15146-ACR
MED22 cDNA ORF Clone, Human, N-OFPSpark® tag HG15146-ANR
MED22 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15146-CF
MED22 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15146-NF
MED22 cDNA ORF Clone, Human, C-His tag HG15146-CH
MED22 cDNA ORF Clone, Human, N-His tag HG15146-NH
MED22 cDNA ORF Clone, Human, C-HA tag HG15146-CY
MED22 cDNA ORF Clone, Human, N-HA tag HG15146-NY
MED22 cDNA ORF Clone, Human, C-Myc tag HG15146-CM
MED22 cDNA ORF Clone, Human, N-Myc tag HG15146-NM
MED22 qPCR Primer Pairs, Human HP103773
info info
添加购物车成功! 添加购物车失败!