MDGA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50431-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MDGA2 Reagents
CRO Services
Product recommended

All MDGA2 Reagents
MDGA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2850 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1056C/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse MAM domain containing glycosylphosphatidylinositol anchor 2 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + NotI (6kb + 2.89kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MDGA2 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MDGA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
Mouse MDGA2 Gene Expression validated Image 2166
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Cynomolgus CDCP1 Gene Plasmid Map 5627
MDGA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
6720489L24Rik cDNA ORF Clone, Mouse;9330209L04Rik cDNA ORF Clone, Mouse;Adp cDNA ORF Clone, Mouse;Mamdc1 cDNA ORF Clone, Mouse
MDGA2 Background Information

MAM domain-containing glycosylphosphatidylinositol anchor protein 2, also known as MAM domain-containing protein 1, MDGA2 and MAMDC1, is a cell membrane protein which contains six Ig-like (immunoglobulin-like) domains and one MAM domain. Analyses of the full-length coding region of MDGA1 and MDGA2 indicate that they encode proteins that comprise a novel subgroup of the Ig superfamily and have a unique structural organization consisting of six immunoglobulin (Ig)-like domains followed by a single MAM domain. Biochemical characterization demonstrates that MDGA1 and MDGA2 proteins are highly glycosylated, and that MDGA1 is tethered to the cell membrane by a GPI anchor. The MDGAs are differentially expressed by subpopulations of neurons in both the central and peripheral nervous systems, including neurons of the basilar pons, inferior olive, cerebellum, cerebral cortex, olfactory bulb, spinal cord, and dorsal root and trigeminal ganglia. The similarity of MDGAs to other Ig-containing molecules and their temporal-spatial patterns of expression within restricted neuronal populations, for example migrating pontine neurons and D1 spinal interneurons, suggest a role for these novel proteins in regulating neuronal migration, as well as other aspects of neural development, including axon guidance.

Full Name
MAM domain containing glycosylphosphatidylinositol anchor 2
References
  • Litwack,ED. et al., 2004, Mol Cell Neurosci. 25 (2): 263-74.
  • Hellquist, A. et al., 2009, PLoS One. 4 (12): e8037.
  • Sano,S. et al., 2009, Genesis. 47 (8):505-13.
  • Bucan, M. et al., 2009, PLoS Genet. 5 (6):e1000536.
  • MDGA2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MDGA2 cDNA ORF Clone in Cloning Vector, Mouse MG50431-M
    MDGA2 cDNA ORF Clone, Mouse, untagged MG50431-UT
    MDGA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50431-ACG
    MDGA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50431-ACGLN
    MDGA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50431-ACR
    MDGA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50431-NF
    MDGA2 cDNA ORF Clone, Mouse, C-His tag MG50431-CH
    MDGA2 cDNA ORF Clone, Mouse, N-His tag MG50431-NH
    MDGA2 cDNA ORF Clone, Mouse, C-HA tag MG50431-CY
    MDGA2 cDNA ORF Clone, Mouse, N-HA tag MG50431-NY
    MDGA2 cDNA ORF Clone, Mouse, C-Myc tag MG50431-CM
    MDGA2 cDNA ORF Clone, Mouse, N-Myc tag MG50431-NM
    MDGA2 qPCR Primer Pairs, Mouse MP200089

    MDGA2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MDGA2 cDNA ORF Clone in Cloning Vector, Human HG11372-M
    MDGA2 cDNA ORF Clone, Human, untagged HG11372-UT
    MDGA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11372-ACGLN
    MDGA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG11372-ACG
    MDGA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG11372-ACR
    MDGA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11372-CF
    MDGA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11372-NF
    MDGA2 cDNA ORF Clone, Human, C-His tag HG11372-CH
    MDGA2 cDNA ORF Clone, Human, N-His tag HG11372-NH
    MDGA2 cDNA ORF Clone, Human, C-HA tag HG11372-CY
    MDGA2 cDNA ORF Clone, Human, N-HA tag HG11372-NY
    MDGA2 cDNA ORF Clone, Human, C-Myc tag HG11372-CM
    MDGA2 cDNA ORF Clone, Human, N-Myc tag HG11372-NM
    MDGA2 qPCR Primer Pairs, Human HP101254
    info info
    添加购物车成功! 添加购物车失败!