Quick Order

Mouse MCPT1 Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse MCPT1 cDNA Clone Product Information
    NCBI RefSeq:NM_008570.1
    RefSeq ORF Size:675bp
    cDNA Description:Full length Clone DNA of Mus musculus mast cell protease 1 with N terminal His tag.
    Gene Synonym:Mcp-1, AV080368, Mcpt1
    Species:Mouse
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with MCPT1 qPCR primers for gene expression analysis, MP200247 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Mast Cell Protease 1 (MMCP-1), also known as MCP-1, MCPT-1 and β-chymase, is a member of the Chymase family of chymotrypsin-like serine proteases. MCPT-1 is a 26 kDa β-chymase that is a component of mast cell granules. It is a 226 amino acid (aa) protein that has a conserved pattern of six cysteines and one potential glycosylation site. The granule-derived mouse mast cell proteases-1 and -2 (mMCP-1 and -2) colocalize in similar quantities in mucosal mast cells but micrograms of mMCP-1 compared with nanograms of mMCP-2 are detected in peripheral blood during intestinal nematode infection. mMCP-1 isolated from serum is complexed with serpins and both the accumulation and the longevity of mMCP-1 in blood is due to complex formation, protecting it from a pathway that rapidly clears mMCP-2, which is unable to form complexes with serpins. The mucosal mast cell (MMC) granule-specific beta-chymase, mouse mast cell protease-1 (mMCP-1), is released systemically into the bloodstream early in nematode infection before parasite-specific IgE responses develop and TGF-beta1 induces constitutive release of mMCP-1 by homologues of MMC in vitro. Expression of mMCP-1 is largely restricted to intraepithelial MMC and is thought to play a role in the regulation of epithelial permeability. Its activation is completed by the removal of a two residue N-terminal propeptide by a dipeptidyl peptidase (Cathepsin C). MCPT-1 is upregulated in the intestine in response to nematode infection, or in systemic mucosa in response to anaphylaxis. Like human α-chymase, MCPT-1 is capable of the conversion of angiotensin I to angiotensin II, which plays a key role in the regulation of arterial pressure. The intestinal inflammation associated with gastrointestinal helminths is partly mediated by mMCP-1.

    References
  • Pemberton AD, et al. (2003) Purification and characterization of mouse mast cell proteinase-2 and the differential expression and release of mouse mast cell proteinase-1 and -2 in vivo. Clin Exp Allergy. 33(7): 1005-12.
  • Brown JK, et al. (2003) Constitutive secretion of the granule chymase mouse mast cell protease-1 and the chemokine, CCL2, by mucosal mast cell homologues. Clin Exp Allergy. 33(1): 132-46.
  • Lawrence CE, et al. (2004) Mouse mast cell protease-1 is required for the enteropathy induced by gastrointestinal helminth infection in the mouse. Gastroenterology. 127(1): 155-65.
  • Pemberton AD, et al. (2006) Anaphylactic release of mucosal mast cell granule proteases: role of serpins in the differential clearance of mouse mast cell proteases-1 and -2. J Immunol. 176(2): 899-904.
  • Size / Price
    Catalog: MG50220-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"