After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MCPT1 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse MCPT1 cDNA Clone Product Information
NCBI RefSeq:NM_008570.1
RefSeq ORF Size:675bp
cDNA Description:Full length Clone DNA of Mus musculus mast cell protease 1 with N terminal His tag.
Gene Synonym:Mcp-1, AV080368, Mcpt1
Species:Mouse
Vector:pCMV3-SP-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mouse Mast Cell Protease 1 (MMCP-1), also known as MCP-1, MCPT-1 and β-chymase, is a member of the Chymase family of chymotrypsin-like serine proteases. MCPT-1 is a 26 kDa β-chymase that is a component of mast cell granules. It is a 226 amino acid (aa) protein that has a conserved pattern of six cysteines and one potential glycosylation site. The granule-derived mouse mast cell proteases-1 and -2 (mMCP-1 and -2) colocalize in similar quantities in mucosal mast cells but micrograms of mMCP-1 compared with nanograms of mMCP-2 are detected in peripheral blood during intestinal nematode infection. mMCP-1 isolated from serum is complexed with serpins and both the accumulation and the longevity of mMCP-1 in blood is due to complex formation, protecting it from a pathway that rapidly clears mMCP-2, which is unable to form complexes with serpins. The mucosal mast cell (MMC) granule-specific beta-chymase, mouse mast cell protease-1 (mMCP-1), is released systemically into the bloodstream early in nematode infection before parasite-specific IgE responses develop and TGF-beta1 induces constitutive release of mMCP-1 by homologues of MMC in vitro. Expression of mMCP-1 is largely restricted to intraepithelial MMC and is thought to play a role in the regulation of epithelial permeability. Its activation is completed by the removal of a two residue N-terminal propeptide by a dipeptidyl peptidase (Cathepsin C). MCPT-1 is upregulated in the intestine in response to nematode infection, or in systemic mucosa in response to anaphylaxis. Like human α-chymase, MCPT-1 is capable of the conversion of angiotensin I to angiotensin II, which plays a key role in the regulation of arterial pressure. The intestinal inflammation associated with gastrointestinal helminths is partly mediated by mMCP-1.

References
  • Pemberton AD, et al. (2003) Purification and characterization of mouse mast cell proteinase-2 and the differential expression and release of mouse mast cell proteinase-1 and -2 in vivo. Clin Exp Allergy. 33(7): 1005-12.
  • Brown JK, et al. (2003) Constitutive secretion of the granule chymase mouse mast cell protease-1 and the chemokine, CCL2, by mucosal mast cell homologues. Clin Exp Allergy. 33(1): 132-46.
  • Lawrence CE, et al. (2004) Mouse mast cell protease-1 is required for the enteropathy induced by gastrointestinal helminth infection in the mouse. Gastroenterology. 127(1): 155-65.
  • Pemberton AD, et al. (2006) Anaphylactic release of mucosal mast cell granule proteases: role of serpins in the differential clearance of mouse mast cell proteases-1 and -2. J Immunol. 176(2): 899-904.
  • Size / Price
    Catalog: MG50220-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        Recently Viewed Items
          All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
          Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"