MCFD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51686-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MCFD2 Reagents
CRO Services
Product recommended

All MCFD2 Reagents
MCFD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
438 bp
Description
Full length Clone DNA of Mouse multiple coagulation factor deficiency 2
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCFD2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1810021C21Rik cDNA ORF Clone, Mouse;F5f8d cDNA ORF Clone, Mouse;Lman1ip cDNA ORF Clone, Mouse;Sdnsf cDNA ORF Clone, Mouse
MCFD2 Background Information
Full Name
multiple coagulation factor deficiency 2

MCFD2 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MCFD2 cDNA ORF Clone in Cloning Vector, Rat RG85421-U
MCFD2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG85421-ACGLN

MCFD2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MCFD2 cDNA ORF Clone in Cloning Vector, Mouse MG51686-U
MCFD2 cDNA ORF Clone, Mouse, untagged MG51686-UT
MCFD2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51686-ACGLN
MCFD2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51686-ACG
MCFD2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51686-ACR
MCFD2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51686-NF
MCFD2 cDNA ORF Clone, Mouse, C-His tag MG51686-CH
MCFD2 cDNA ORF Clone, Mouse, N-His tag MG51686-NH
MCFD2 cDNA ORF Clone, Mouse, C-HA tag MG51686-CY
MCFD2 cDNA ORF Clone, Mouse, N-HA tag MG51686-NY
MCFD2 cDNA ORF Clone, Mouse, C-Myc tag MG51686-CM
MCFD2 cDNA ORF Clone, Mouse, N-Myc tag MG51686-NM
MCFD2 qPCR Primer Pairs, Mouse MP201559

MCFD2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MCFD2 cDNA ORF Clone in Cloning Vector, Human HG13332-G
MCFD2 cDNA ORF Clone, Human, untagged HG13332-UT
MCFD2 cDNA ORF Clone, Human, C-GFPSpark® tag HG13332-ACG
MCFD2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13332-ACGLN
MCFD2 cDNA ORF Clone, Human, C-OFPSpark® tag HG13332-ACR
MCFD2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13332-CF
MCFD2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13332-NF
MCFD2 cDNA ORF Clone, Human, C-His tag HG13332-CH
MCFD2 cDNA ORF Clone, Human, N-His tag HG13332-NH
MCFD2 cDNA ORF Clone, Human, C-HA tag HG13332-CY
MCFD2 cDNA ORF Clone, Human, N-HA tag HG13332-NY
MCFD2 cDNA ORF Clone, Human, C-Myc tag HG13332-CM
MCFD2 cDNA ORF Clone, Human, N-Myc tag HG13332-NM
MCFD2 qPCR Primer Pairs, Human HP102037
info info
添加购物车成功! 添加购物车失败!