MCCC2 cDNA ORF Clone, Mouse, C-HA tag

Cat: MG51880-CY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MCCC2 Reagents
CRO Services
Product recommended

All MCCC2 Reagents
MCCC2 cDNA ORF Clone, Mouse, C-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1692 bp
Description
Full length Clone DNA of Mouse methylcrotonoyl-Coenzyme A carboxylase 2 (beta) with C terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MCCC2 cDNA ORF Clone, Mouse, C-HA tag Alternative Names
4930552N12Rik cDNA ORF Clone, Mouse;MCCB cDNA ORF Clone, Mouse
MCCC2 Background Information
Full Name
methylcrotonoyl-CoA carboxylase 2 (beta)

MCCC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MCCC2 cDNA ORF Clone in Cloning Vector, Mouse MG51880-G
MCCC2 cDNA ORF Clone, Mouse, untagged MG51880-UT
MCCC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51880-ACGLN
MCCC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51880-ACG
MCCC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51880-ANG
MCCC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51880-ACR
MCCC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51880-ANR
MCCC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51880-CF
MCCC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51880-NF
MCCC2 cDNA ORF Clone, Mouse, C-His tag MG51880-CH
MCCC2 cDNA ORF Clone, Mouse, N-His tag MG51880-NH
MCCC2 cDNA ORF Clone, Mouse, N-HA tag MG51880-NY
MCCC2 cDNA ORF Clone, Mouse, C-Myc tag MG51880-CM
MCCC2 cDNA ORF Clone, Mouse, N-Myc tag MG51880-NM
MCCC2 qPCR Primer Pairs, Mouse MP201753

MCCC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MCCC2 cDNA ORF Clone in Cloning Vector, Human HG15268-G
MCCC2 cDNA ORF Clone, Human, untagged HG15268-UT
MCCC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG15268-ACG
MCCC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG15268-ACGLN
MCCC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG15268-ANG
MCCC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG15268-ACR
MCCC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG15268-ANR
MCCC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG15268-CF
MCCC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG15268-NF
MCCC2 cDNA ORF Clone, Human, C-His tag HG15268-CH
MCCC2 cDNA ORF Clone, Human, N-His tag HG15268-NH
MCCC2 cDNA ORF Clone, Human, C-HA tag HG15268-CY
MCCC2 cDNA ORF Clone, Human, N-HA tag HG15268-NY
MCCC2 cDNA ORF Clone, Human, C-Myc tag HG15268-CM
MCCC2 cDNA ORF Clone, Human, N-Myc tag HG15268-NM
MCCC2 qPCR Primer Pairs, Human HP103894
info info
添加购物车成功! 添加购物车失败!