MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG51202-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MBP/Myelin Basic Protein Reagents
CRO Services
Product recommended

All MBP/Myelin Basic Protein Reagents
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
387 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse myelin basic protein with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Restriction Sites
KpnI + XbaI (6kb + 0.44kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
MBP/Myelin Basic Protein cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
Mouse MBP/Myelin Basic Protein Gene Expression validated Image 2276
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF01). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
Human aFGF/FGF1 Gene Plasmid Map 5637
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
C76307 cDNA ORF Clone, Mouse;golli-mbp cDNA ORF Clone, Mouse;Hmbpr cDNA ORF Clone, Mouse;mld cDNA ORF Clone, Mouse;R75289 cDNA ORF Clone, Mouse;shi cDNA ORF Clone, Mouse
MBP/Myelin Basic Protein Background Information
Full Name
myelin basic protein

MBP/Myelin Basic Protein cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
MBP/Myelin Basic Protein cDNA ORF Clone in Cloning Vector, Rat RG81319-G
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, untagged RG81319-UT
MBP/Myelin Basic Protein Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81319-ACGLN
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, C-GFPSpark® tag RG81319-ACG
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, N-GFPSpark® tag RG81319-ANG
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, C-OFPSpark® tag RG81319-ACR
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, N-OFPSpark® tag RG81319-ANR
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81319-CF
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81319-NF
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, C-His tag RG81319-CH
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, N-His tag RG81319-NH
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, C-HA tag RG81319-CY
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, N-HA tag RG81319-NY
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, C-Myc tag RG81319-CM
MBP/Myelin Basic Protein cDNA ORF Clone, Rat, N-Myc tag RG81319-NM
MBP/Myelin Basic Protein qPCR Primer Pairs, Rat RP301290

MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MBP/Myelin Basic Protein cDNA ORF Clone in Cloning Vector, Mouse MG51202-U
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, untagged MG51202-UT
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51202-ACG
MBP/Myelin Basic Protein Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51202-ACGLN
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-GFPSpark® tag MG5A7640-ACG
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51202-ANG
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51202-ACR
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51202-ANR
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG5A7640-CF
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51202-CF
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-His tag MG51202-CH
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-His tag MG51202-NH
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-HA tag MG51202-CY
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-HA tag MG51202-NY
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, C-Myc tag MG51202-CM
MBP/Myelin Basic Protein cDNA ORF Clone, Mouse, N-Myc tag MG51202-NM
MBP/Myelin Basic Protein qPCR Primer Pairs, Mouse MP201086

MBP/Myelin Basic Protein cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MBP/Myelin Basic Protein cDNA ORF Clone in Cloning Vector, Human HG11167-M
MBP/Myelin Basic Protein cDNA ORF Clone, Human, untagged HG11167-UT
MBP/Myelin Basic Protein Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11167-ACGLN
MBP/Myelin Basic Protein cDNA ORF Clone, Human, C-GFPSpark® tag HG11167-ACG
MBP/Myelin Basic Protein cDNA ORF Clone, Human, C-OFPSpark® tag HG11167-ACR
MBP/Myelin Basic Protein cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11167-CF
MBP/Myelin Basic Protein cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11167-NF
MBP/Myelin Basic Protein cDNA ORF Clone, Human, C-His tag HG11167-CH
MBP/Myelin Basic Protein cDNA ORF Clone, Human, N-His tag HG11167-NH
MBP/Myelin Basic Protein cDNA ORF Clone, Human, C-HA tag HG11167-CY
MBP/Myelin Basic Protein cDNA ORF Clone, Human, N-HA tag HG11167-NY
MBP/Myelin Basic Protein cDNA ORF Clone, Human, C-Myc tag HG11167-CM
MBP/Myelin Basic Protein cDNA ORF Clone, Human, N-Myc tag HG11167-NM
MBP/Myelin Basic Protein qPCR Primer Pairs, Human HP101074
info info
添加购物车成功! 添加购物车失败!