MASTL/THC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51040-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MASTL/THC2 Reagents
CRO Services
Product recommended

All MASTL/THC2 Reagents
MASTL/THC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2598 bp
Description
Full length Clone DNA of Mouse microtubule associated serine/threonine kinase-like with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MASTL/THC2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
2700091H24Rik cDNA ORF Clone, Mouse;C88295 cDNA ORF Clone, Mouse;GW cDNA ORF Clone, Mouse;GWL cDNA ORF Clone, Mouse;MAST-L cDNA ORF Clone, Mouse;THC2 cDNA ORF Clone, Mouse
MASTL/THC2 Background Information
Full Name
microtubule associated serine/threonine kinase-like

MASTL/THC2 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MASTL/THC2 cDNA ORF Clone in Cloning Vector, Mouse MG51040-G
MASTL/THC2 cDNA ORF Clone, Mouse, untagged MG51040-UT
MASTL/THC2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51040-ACGLN
MASTL/THC2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51040-ACG
MASTL/THC2 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51040-ANG
MASTL/THC2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51040-ACR
MASTL/THC2 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51040-ANR
MASTL/THC2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51040-NF
MASTL/THC2 cDNA ORF Clone, Mouse, C-His tag MG51040-CH
MASTL/THC2 cDNA ORF Clone, Mouse, N-His tag MG51040-NH
MASTL/THC2 cDNA ORF Clone, Mouse, C-HA tag MG51040-CY
MASTL/THC2 cDNA ORF Clone, Mouse, N-HA tag MG51040-NY
MASTL/THC2 cDNA ORF Clone, Mouse, C-Myc tag MG51040-CM
MASTL/THC2 cDNA ORF Clone, Mouse, N-Myc tag MG51040-NM
MASTL/THC2 qPCR Primer Pairs, Mouse MP200999

MASTL/THC2 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MASTL/THC2 cDNA ORF Clone in Cloning Vector, Human HG10761-M
MASTL/THC2 cDNA ORF Clone, Human, untagged HG10761-UT
MASTL/THC2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10761-ACGLN
MASTL/THC2 cDNA ORF Clone, Human, C-GFPSpark® tag HG10761-ACG
MASTL/THC2 cDNA ORF Clone, Human, N-GFPSpark® tag HG10761-ANG
MASTL/THC2 cDNA ORF Clone, Human, C-OFPSpark® tag HG10761-ACR
MASTL/THC2 cDNA ORF Clone, Human, N-OFPSpark® tag HG10761-ANR
MASTL/THC2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10761-CF
MASTL/THC2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10761-NF
MASTL/THC2 cDNA ORF Clone, Human, C-His tag HG10761-CH
MASTL/THC2 cDNA ORF Clone, Human, N-His tag HG10761-NH
MASTL/THC2 cDNA ORF Clone, Human, C-HA tag HG10761-CY
MASTL/THC2 cDNA ORF Clone, Human, N-HA tag HG10761-NY
MASTL/THC2 cDNA ORF Clone, Human, C-Myc tag HG10761-CM
MASTL/THC2 cDNA ORF Clone, Human, N-Myc tag HG10761-NM
MASTL/THC2 qPCR Primer Pairs, Human HP100687
info info
添加购物车成功! 添加购物车失败!