MAPKAPK3 cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG50857-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MAPKAPK3 Reagents
CRO Services
Product recommended

All MAPKAPK3 Reagents
MAPKAPK3 cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1155 bp
Description
Full length Clone DNA of Mouse mitogen-activated protein kinase-activated protein kinase 3 with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAPKAPK3 cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
3PK cDNA ORF Clone, Mouse;AI874665 cDNA ORF Clone, Mouse;MAPKAP-K3 cDNA ORF Clone, Mouse;MAPKAP3 cDNA ORF Clone, Mouse;MapkKapk3 cDNA ORF Clone, Mouse;MK-3 cDNA ORF Clone, Mouse;MK3 cDNA ORF Clone, Mouse
MAPKAPK3 Background Information

The MAPKAP kinases are a group of MAP kinase substrates which are themselves kinases. In response to activation, the MAP kinases phosphorylate downstream components on a consensus Pro-X-Ser/Thr-Pro motif. Several kinases that contain this motif have been identifed and serve as substrates for the ERK and p38 MAP kinases. Mitogen-activated protein (MAP) kinase-activated protein kinase 3, also known as MAPKAPK-3 and 3pK, is a member of the Ser/Thr protein kinase family. It is Widely expressed in human tissues, with a higher expression level observed in heart and skeletal muscle. No expression in brain. MAPKAPK-3 is unique since it was shown to be activated by three members of the MAPK family, namely extracellular-signal-regulated kinase (ERK), p38, and Jun-N-terminal kinase (JNK). It is highly activated both by mitogens and by stress-inducing agents or proinflammatory cytokines, and translocates to the cytoplasm from nucleus. MAPKAPK-3 is exclusively activated via the classical MAPK cascade, while stress-induced activation of MAPKAPK-3 is mainly mediated by p38, however the mechanism defining the specificity remains unknown.

Full Name
mitogen-activated protein kinase-activated protein kinase 3
References
  • McLaughlin, M.M. et al., 1996, J. Biol. Chem. 271:8488-8492.
  • Tanoue, T. et al., 2001, EMBO J. 20: 466-479.
  • Neufeld, B. et al., 2000, J. Biol. Chem. 275: 20239-20242.
  • Zakowski,V. et al., 2004, Exp Cell Res. 299: 101-109.
  • Voncken, J. W. et al., 2005, J. Biol. Chem. 280: 5178-5187.
  • MAPKAPK3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    MAPKAPK3 cDNA ORF Clone in Cloning Vector, Mouse MG50857-G
    MAPKAPK3 cDNA ORF Clone, Mouse, untagged MG50857-UT
    MAPKAPK3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50857-ACGLN
    MAPKAPK3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50857-ACG
    MAPKAPK3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50857-ANG
    MAPKAPK3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50857-ACR
    MAPKAPK3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50857-ANR
    MAPKAPK3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50857-CF
    MAPKAPK3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50857-NF
    MAPKAPK3 cDNA ORF Clone, Mouse, C-His tag MG50857-CH
    MAPKAPK3 cDNA ORF Clone, Mouse, N-His tag MG50857-NH
    MAPKAPK3 cDNA ORF Clone, Mouse, C-HA tag MG50857-CY
    MAPKAPK3 cDNA ORF Clone, Mouse, N-HA tag MG50857-NY
    MAPKAPK3 cDNA ORF Clone, Mouse, C-Myc tag MG50857-CM
    MAPKAPK3 qPCR Primer Pairs, Mouse MP200828

    MAPKAPK3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    MAPKAPK3 cDNA ORF Clone in Cloning Vector, Human HG10683-M
    MAPKAPK3 cDNA ORF Clone, Human, untagged HG10683-UT
    MAPKAPK3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10683-ACGLN
    MAPKAPK3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10683-ACG
    MAPKAPK3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10683-ANG
    MAPKAPK3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10683-ACR
    MAPKAPK3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10683-ANR
    MAPKAPK3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10683-CF
    MAPKAPK3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10683-NF
    MAPKAPK3 cDNA ORF Clone, Human, C-His tag HG10683-CH
    MAPKAPK3 cDNA ORF Clone, Human, N-His tag HG10683-NH
    MAPKAPK3 cDNA ORF Clone, Human, C-HA tag HG10683-CY
    MAPKAPK3 cDNA ORF Clone, Human, N-HA tag HG10683-NY
    MAPKAPK3 cDNA ORF Clone, Human, C-Myc tag HG10683-CM
    MAPKAPK3 cDNA ORF Clone, Human, N-Myc tag HG10683-NM
    MAPKAPK3 qPCR Primer Pairs, Human HP100646
    info info
    添加购物车成功! 添加购物车失败!