Quick Order

Mouse MAPKAPK3/MK3 Gene ORF cDNA clone expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse MAPKAPK3 cDNA Clone Product Information
NCBI RefSeq:NM_178907.3
RefSeq ORF Size:1155bp
cDNA Description:Full length Clone DNA of Mus musculus mitogen-activated protein kinase-activated protein kinase 3 with N terminal His tag.
Gene Synonym:3PK, MK3, MAPKAP3, AI874665, MapkKapk3, Mapkapk3
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

The MAPKAP kinases are a group of MAP kinase substrates which are themselves kinases. In response to activation, the MAP kinases phosphorylate downstream components on a consensus Pro-X-Ser/Thr-Pro motif. Several kinases that contain this motif have been identifed and serve as substrates for the ERK and p38 MAP kinases. Mitogen-activated protein (MAP) kinase-activated protein kinase 3, also known as MAPKAPK-3 and 3pK, is a member of the Ser/Thr protein kinase family. It is Widely expressed in human tissues, with a higher expression level observed in heart and skeletal muscle. No expression in brain. MAPKAPK-3 is unique since it was shown to be activated by three members of the MAPK family, namely extracellular-signal-regulated kinase (ERK), p38, and Jun-N-terminal kinase (JNK). It is highly activated both by mitogens and by stress-inducing agents or proinflammatory cytokines, and translocates to the cytoplasm from nucleus. MAPKAPK-3 is exclusively activated via the classical MAPK cascade, while stress-induced activation of MAPKAPK-3 is mainly mediated by p38, however the mechanism defining the specificity remains unknown.

References
  • McLaughlin, M.M. et al., 1996, J. Biol. Chem. 271:8488-8492.
  • Tanoue, T. et al., 2001, EMBO J. 20: 466-479.
  • Neufeld, B. et al., 2000, J. Biol. Chem. 275: 20239-20242.
  • Zakowski,V. et al., 2004, Exp Cell Res. 299: 101-109.
  • Voncken, J. W. et al., 2005, J. Biol. Chem. 280: 5178-5187.
  • Size / Price
    Catalog: MG50857-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"