Quick Order

Mouse MKK4/MEK4/MAP2K4 Gene ORF cDNA clone expression plasmid, C-HA tag

DatasheetReviewsRelated ProductsProtocols
Mouse MAP2K4 cDNA Clone Product Information
NCBI RefSeq:NM_009157.4
RefSeq ORF Size:1194bp
cDNA Description:Full length Clone DNA of Mus musculus mitogen-activated protein kinase kinase 4 with C terminal HA tag.
Gene Synonym:MEK4, MKK4, Sek1, JNKK1, Serk1, PRKMK4, Map2k4
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse dual specificity mitogen-activated protein kinase kinase 4, also known as MAP kinase kinase 4, MAPKK4, JNK-activating kinase 1, MAPK/ERK kinase 4, SAPK/ERK kinase 1, c-Jun N-terminal kinase kinase 1, JNKK and MAP2K4, is a protein which belongs to the protein kinase superfamily, STE Ser/Thr protein kinase family and MAP kinase kinase subfamily. MAP2K4 / JNKK1 is a protein kinase which is a direct activator of MAP kinases in response to various environmental stresses or mitogenic stimuli. MAP2K4 / JNKK1 has been shown to activate MAPK8 / JNK1, MAPK9 / JNK2, and MAPK14 / p38, but not MAPK1 / ERK2 or MAPK3 / ERK1. MAP2K4 / JNKK1 is phosphorylated, and thus activated by MAP3K1 / MEKK. The stress-activated protein kinase (SAPK) pathways represent phosphorylation cascades that convey pro-apoptotic signals. The mitogen-activated protein kinase kinase (MAPKK) homolog MAP2K4 ( MKK4, SEK, JNKK1 ) is a centrally-placed mediator of the SAPK pathways.

References
  • Lin A, et al.,1995, Science 268 (5208): 286-90.
  • Su,G.H. et al., 2002, Hum Mutat. 19 (1):81.
  • Lee, et al., 2002, Proc. Natl. Acad. Sci. USA. 99 (22): 14189-94.
  • Bouzakri,K. et al., 2007, J Biol Chem. 282 (11):7783-9.
  • Size / Price
    Catalog: MG50643-CY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"