MAGED1 cDNA ORF Clone, Mouse, untagged

Cat: MG51399-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All MAGED1 Reagents
CRO Services
Product recommended

All MAGED1 Reagents
MAGED1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2328 bp
Description
Full length Clone DNA of Mouse melanoma antigen, family D, 1
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

MAGED1 cDNA ORF Clone, Mouse, untagged Alternative Names
2810433C11Rik cDNA ORF Clone, Mouse;5430405L04Rik cDNA ORF Clone, Mouse;Dlixin cDNA ORF Clone, Mouse;Dlxin-1 cDNA ORF Clone, Mouse;Dlxin1 cDNA ORF Clone, Mouse;DXBwg1492e cDNA ORF Clone, Mouse;MAGE-D1 cDNA ORF Clone, Mouse;mFLJ00163 cDNA ORF Clone, Mouse;NRAGE cDNA ORF Clone, Mouse
MAGED1 Background Information
Full Name
MAGE family member D1

MAGED1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
MAGED1 cDNA ORF Clone in Cloning Vector, Mouse MG51399-U
MAGED1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51399-ACG
MAGED1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51399-ACGLN
MAGED1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51399-ANG
MAGED1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51399-ACR
MAGED1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51399-ANR
MAGED1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51399-CF
MAGED1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51399-NF
MAGED1 cDNA ORF Clone, Mouse, C-His tag MG51399-CH
MAGED1 cDNA ORF Clone, Mouse, N-His tag MG51399-NH
MAGED1 cDNA ORF Clone, Mouse, C-HA tag MG51399-CY
MAGED1 cDNA ORF Clone, Mouse, N-HA tag MG51399-NY
MAGED1 cDNA ORF Clone, Mouse, C-Myc tag MG51399-CM
MAGED1 cDNA ORF Clone, Mouse, N-Myc tag MG51399-NM
MAGED1 qPCR Primer Pairs, Mouse MP201269

MAGED1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
MAGED1 cDNA ORF Clone in Cloning Vector, Human HG11367-M
MAGED1 cDNA ORF Clone, Human, untagged HG11367-UT
MAGED1 cDNA ORF Clone, Human, C-GFPSpark® tag HG11367-ACG
MAGED1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11367-ACGLN
MAGED1 cDNA ORF Clone, Human, N-GFPSpark® tag HG11367-ANG
MAGED1 cDNA ORF Clone, Human, C-OFPSpark® tag HG11367-ACR
MAGED1 cDNA ORF Clone, Human, N-OFPSpark® tag HG11367-ANR
MAGED1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11367-CF
MAGED1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11367-NF
MAGED1 cDNA ORF Clone, Human, C-His tag HG11367-CH
MAGED1 cDNA ORF Clone, Human, N-His tag HG11367-NH
MAGED1 cDNA ORF Clone, Human, C-HA tag HG11367-CY
MAGED1 cDNA ORF Clone, Human, N-HA tag HG11367-NY
MAGED1 cDNA ORF Clone, Human, C-Myc tag HG11367-CM
MAGED1 cDNA ORF Clone, Human, N-Myc tag HG11367-NM
MAGED1 qPCR Primer Pairs, Human HP101249
info info
添加购物车成功! 添加购物车失败!