Leptin cDNA ORF Clone, Mouse, untagged

Cat: MG50442-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Leptin Reagents
CRO Services
Product recommended

All Leptin Reagents
Leptin cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
504 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 6 C>T not causing the amino acid variation.
Description
Full length Clone DNA of Mouse leptin.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + XbaI (6.1kb + 0.5kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Leptin cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Leptin cDNA ORF Clone, Mouse, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5613
Leptin cDNA ORF Clone, Mouse, untagged Alternative Names
ob cDNA ORF Clone, Mouse;obese cDNA ORF Clone, Mouse
Leptin Background Information

Leptin is one of the most important hormones secreted by adipocytes, as an adipokine that modulates multiple functions including energy homeostasis, thermoregulation, bone metabolism, endocrine and pro-inflammatory immune responses. The circulating leptin levels serve as a gauge of energy stores, thereby directing the regulation of energy homeostasis, neuroendocrine function, and metabolism. Recent studies suggest that leptin is physiologically more important as an indicator of energy deficiency, rather than energy excess, and may mediate adaptation by driving increased food intake and directing neuroendocrine function to converse energy, such as inducing hypothalamic hypogonadism to prevent fertilization. One of these functions is the connection between nutritional status and immune competence. The adipocyte-derived hormone Leptin has been shown to regulate the immune response, innate and adaptive response, both in normal and pathological conditions. Thus, Leptin is a mediator of the inflammatory response. Leptin has a dual effect on bone, acting by two independent mechanisms. As a signal molecule with growth factor characteristics, leptin is able to stimulate osteoblastic cells and to inhibit osteoclast formation and activity, thus promoting osteogenesis. However, as a molecule which stimulates sympathetic neurons in the hypothalamus, leptin indirectly inhibits bone formation. This inhibitory effect of leptin mediated by activation of sympathetic nervous system can be abrogated by application of blood pressure-reducing beta-blockers, which also inhibit receptors of hypothalamic adrenergic neurons. Leptin appears to regulate a number of features defining Alzheimer's disease (AD) at the molecular and physiological level. Leptin can stimulate mitogenic and angiogenic processes in peripheral organs. Because leptin levels are elevated in obese individuals and excess body weight has been shown to increase breast cancer risk in postmenopausal women. Furthermore, a recent report clearly shows that targeting leptin signaling may reduce mammary carcinogenesis.

Full Name
leptin
References
  • Surmacz E. (2007) Obesity hormone leptin: a new target in breast cancer? Breast Cancer Res. 9(1): 301.
  • Wodarski K, et al. (2009) Leptin as a modulator of osteogenesis. Ortop Traumatol Rehabil. 11(1): 1-6.
  • Tezapsidis N, et al. (2009) Leptin: a novel therapeutic strategy for Alzheimer's disease. J Alzheimers Dis. 16(4): 731-40.
  • Cai C, et al. (2009) Leptin in non-autoimmune inflammation. Inflamm Allergy Drug Targets. 8(4): 285-91.
  • Fernndez-Riejos P, et al. (2010) Role of leptin in the activation of immune cells. Mediators Inflamm. 2010: 568343.
  • Kelesidis T, et al. (2010) Narrative review: the role of leptin in human physiology: emerging clinical applications. Ann Intern Med. 152(2): 93-100.
  • Leptin cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Leptin cDNA ORF Clone in Cloning Vector, Mouse MG50442-M
    Leptin Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50442-ACGLN
    Leptin cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50442-ACG
    Leptin cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50442-ACR
    Leptin cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50442-CF
    Leptin cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50442-NF
    Leptin cDNA ORF Clone, Mouse, C-His tag MG50442-CH
    Leptin cDNA ORF Clone, Mouse, N-His tag MG50442-NH
    Leptin cDNA ORF Clone, Mouse, C-HA tag MG50442-CY
    Leptin cDNA ORF Clone, Mouse, N-HA tag MG50442-NY
    Leptin cDNA ORF Clone, Mouse, C-Myc tag MG50442-CM
    Leptin cDNA ORF Clone, Mouse, N-Myc tag MG50442-NM
    Leptin qPCR Primer Pairs, Mouse MP200451

    Leptin cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Leptin cDNA ORF Clone in Cloning Vector, Human HG10221-M
    Leptin cDNA ORF Clone, Human, untagged HG10221-UT
    Leptin cDNA ORF Clone, Human, C-GFPSpark® tag HG10221-ACG
    Leptin Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10221-ACGLN
    Leptin cDNA ORF Clone, Human, C-OFPSpark® tag HG10221-ACR
    Leptin cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10221-CF
    Leptin cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10221-NF
    Leptin cDNA ORF Clone, Human, C-His tag HG10221-CH
    Leptin cDNA ORF Clone, Human, N-His tag HG10221-NH
    Leptin cDNA ORF Clone, Human, C-HA tag HG10221-CY
    Leptin cDNA ORF Clone, Human, N-HA tag HG10221-NY
    Leptin cDNA ORF Clone, Human, C-Myc tag HG10221-CM
    Leptin cDNA ORF Clone, Human, N-Myc tag HG10221-NM
    Leptin qPCR Primer Pairs, Human HP100276
    info info
    添加购物车成功! 添加购物车失败!