Text Size:AAA

Mouse Leptin Gene ORF cDNA clone expression plasmid, N-His tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse LEP cDNA Clone Product Information
    NCBI RefSeq:NM_008493.3
    RefSeq ORF Size:504bp
    cDNA Description:Full length Clone DNA of Mus musculus leptin with N terminal His tag.
    Gene Synonym:ob, obese, Lep
    Species:Mouse
    Vector:pCMV3-SP-N-His
    Plasmid:
    Restriction Site:
    Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LEP qPCR primers for gene expression analysis, MP200451 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    His Tag Info

    A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

    Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

    Product nameProduct name
    Background

    Leptin is one of the most important hormones secreted by adipocytes, as an adipokine that modulates multiple functions including energy homeostasis, thermoregulation, bone metabolism, endocrine and pro-inflammatory immune responses. The circulating leptin levels serve as a gauge of energy stores, thereby directing the regulation of energy homeostasis, neuroendocrine function, and metabolism. Recent studies suggest that leptin is physiologically more important as an indicator of energy deficiency, rather than energy excess, and may mediate adaptation by driving increased food intake and directing neuroendocrine function to converse energy, such as inducing hypothalamic hypogonadism to prevent fertilization. One of these functions is the connection between nutritional status and immune competence. The adipocyte-derived hormone Leptin has been shown to regulate the immune response, innate and adaptive response, both in normal and pathological conditions. Thus, Leptin is a mediator of the inflammatory response. Leptin has a dual effect on bone, acting by two independent mechanisms. As a signal molecule with growth factor characteristics, leptin is able to stimulate osteoblastic cells and to inhibit osteoclast formation and activity, thus promoting osteogenesis. However, as a molecule which stimulates sympathetic neurons in the hypothalamus, leptin indirectly inhibits bone formation. This inhibitory effect of leptin mediated by activation of sympathetic nervous system can be abrogated by application of blood pressure-reducing beta-blockers, which also inhibit receptors of hypothalamic adrenergic neurons. Leptin appears to regulate a number of features defining Alzheimer's disease (AD) at the molecular and physiological level. Leptin can stimulate mitogenic and angiogenic processes in peripheral organs. Because leptin levels are elevated in obese individuals and excess body weight has been shown to increase breast cancer risk in postmenopausal women. Furthermore, a recent report clearly shows that targeting leptin signaling may reduce mammary carcinogenesis.

    References
  • Surmacz E. (2007) Obesity hormone leptin: a new target in breast cancer? Breast Cancer Res. 9(1): 301.
  • Wodarski K, et al. (2009) Leptin as a modulator of osteogenesis. Ortop Traumatol Rehabil. 11(1): 1-6.
  • Tezapsidis N, et al. (2009) Leptin: a novel therapeutic strategy for Alzheimer's disease. J Alzheimers Dis. 16(4): 731-40.
  • Cai C, et al. (2009) Leptin in non-autoimmune inflammation. Inflamm Allergy Drug Targets. 8(4): 285-91.
  • Fernndez-Riejos P, et al. (2010) Role of leptin in the activation of immune cells. Mediators Inflamm. 2010: 568343.
  • Kelesidis T, et al. (2010) Narrative review: the role of leptin in human physiology: emerging clinical applications. Ann Intern Med. 152(2): 93-100.
  • Size / Price
    Catalog: MG50442-NH
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"