LYPLA2 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52835-NH
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LYPLA2 Reagents
CRO Services
Product recommended

All LYPLA2 Reagents
LYPLA2 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
696 bp
Description
Full length Clone DNA of Mouse lysophospholipase 2 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYPLA2 cDNA ORF Clone, Mouse, N-His tag Alternative Names
LysoII cDNA ORF Clone, Mouse
LYPLA2 Background Information

Lysophospholipase II (LYPLA2, LPL-II, or LysoPLA II), also known as Acyl-protein thioesterase 2 (APT-2), belongs to the AB hydrolase 2 family. This enzyme has lysophospholipase activity, and may hydrolyze fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acyl-protein thioesterase 1 (APT-1) and Acyl-protein thioesterase 2 (APT-2) are cytosolic lysophospholipid hydrolyzing enzymes. The serum activity of APT-1 may play an important role in determination of the concentration of des-acyl ghrelin in circulation, especially under septic inflammation. APT-2/LYPLA2 is expressed both in CHO-K1 and HeLa cells and its overexpression increased the deacylation rate of single acylated GAP-43 and affected the steady-state localization of diacylated GAP-43 and H-Ras. Thus, the results demonstrate that APT-2/LYPLA2 is the protein thioesterase involved in the acylation/deacylation cycle operating in GAP-43 subcellular distribution.

Full Name
lysophospholipase II
References
  • Satou M, et al. (2010) Identification and characterization of acyl-protein thioesterase 1/lysophospholipase I as a ghrelin deacylation/lysophospholipid hydrolyzing enzyme in fetal bovine serum and conditioned medium. Endocrinology. 151(10): 4765-75.
  • Tomatis VM, et al. (2010) Acyl-protein thioesterase 2 catalyzes the deacylation of peripheral membrane-associated GAP-43. PLoS One. 5(11): e15045.
  • LYPLA2 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    LYPLA2 cDNA ORF Clone in Cloning Vector, Rat RG81685-G
    LYPLA2 cDNA ORF Clone, Rat, untagged RG81685-UT
    LYPLA2 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81685-ACGLN
    LYPLA2 cDNA ORF Clone, Rat, C-GFPSpark® tag RG81685-ACG
    LYPLA2 cDNA ORF Clone, Rat, N-GFPSpark® tag RG81685-ANG
    LYPLA2 cDNA ORF Clone, Rat, C-OFPSpark® tag RG81685-ACR
    LYPLA2 cDNA ORF Clone, Rat, N-OFPSpark® tag RG81685-ANR
    LYPLA2 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81685-CF
    LYPLA2 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81685-NF
    LYPLA2 cDNA ORF Clone, Rat, C-His tag RG81685-CH
    LYPLA2 cDNA ORF Clone, Rat, N-His tag RG81685-NH
    LYPLA2 cDNA ORF Clone, Rat, C-HA tag RG81685-CY
    LYPLA2 cDNA ORF Clone, Rat, N-HA tag RG81685-NY
    LYPLA2 cDNA ORF Clone, Rat, C-Myc tag RG81685-CM
    LYPLA2 cDNA ORF Clone, Rat, N-Myc tag RG81685-NM

    LYPLA2 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LYPLA2 cDNA ORF Clone in Cloning Vector, Mouse MG52835-G
    LYPLA2 cDNA ORF Clone, Mouse, untagged MG52835-UT
    LYPLA2 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52835-ACG
    LYPLA2 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52835-ACGLN
    LYPLA2 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52835-ACR
    LYPLA2 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52835-CF
    LYPLA2 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52835-NF
    LYPLA2 cDNA ORF Clone, Mouse, C-His tag MG52835-CH
    LYPLA2 cDNA ORF Clone, Mouse, C-HA tag MG52835-CY
    LYPLA2 cDNA ORF Clone, Mouse, N-HA tag MG52835-NY
    LYPLA2 cDNA ORF Clone, Mouse, C-Myc tag MG52835-CM
    LYPLA2 cDNA ORF Clone, Mouse, N-Myc tag MG52835-NM

    LYPLA2 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LYPLA2 cDNA ORF Clone in Cloning Vector, Human HG16734-U
    LYPLA2 cDNA ORF Clone, Human, untagged HG12360-UT
    LYPLA2 cDNA ORF Clone, Human, untagged HG16734-UT
    LYPLA2 cDNA ORF Clone, Human, C-GFPSpark® tag HG16734-ACG
    LYPLA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16734-ACGLN
    LYPLA2 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12360-ACGLN
    LYPLA2 cDNA ORF Clone, Human, N-GFPSpark® tag HG16734-ANG
    LYPLA2 cDNA ORF Clone, Human, C-OFPSpark® tag HG16734-ACR
    LYPLA2 cDNA ORF Clone, Human, N-OFPSpark® tag HG16734-ANR
    LYPLA2 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16734-CF
    LYPLA2 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16734-NF
    LYPLA2 cDNA ORF Clone, Human, C-His tag HG16734-CH
    LYPLA2 cDNA ORF Clone, Human, N-His tag HG16734-NH
    LYPLA2 cDNA ORF Clone, Human, C-HA tag HG16734-CY
    LYPLA2 cDNA ORF Clone, Human, N-HA tag HG16734-NY
    LYPLA2 cDNA ORF Clone, Human, C-Myc tag HG16734-CM
    LYPLA2 cDNA ORF Clone, Human, N-Myc tag HG16734-NM
    LYPLA2 qPCR Primer Pairs, Human HP104725
    info info
    添加购物车成功! 添加购物车失败!