Quick Order

Text Size:AAA

Mouse LYPLA2 Gene ORF cDNA clone expression plasmid, C-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse LYPLA2 cDNA Clone Product Information
NCBI RefSeq:NM_011942.1
RefSeq ORF Size:696bp
cDNA Description:Full length Clone DNA of Mus musculus lysophospholipase 2 with C terminal Myc tag.
Gene Synonym:LysoII
Species:Mouse
Vector:pCMV3-C-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Lysophospholipase II (LYPLA2, LPL-II, or LysoPLA II), also known as Acyl-protein thioesterase 2 (APT-2), belongs to the AB hydrolase 2 family. This enzyme has lysophospholipase activity, and may hydrolyze fatty acids from S-acylated cysteine residues in proteins such as trimeric G alpha proteins or HRAS. Acyl-protein thioesterase 1 (APT-1) and Acyl-protein thioesterase 2 (APT-2) are cytosolic lysophospholipid hydrolyzing enzymes. The serum activity of APT-1 may play an important role in determination of the concentration of des-acyl ghrelin in circulation, especially under septic inflammation. APT-2/LYPLA2 is expressed both in CHO-K1 and HeLa cells and its overexpression increased the deacylation rate of single acylated GAP-43 and affected the steady-state localization of diacylated GAP-43 and H-Ras. Thus, the results demonstrate that APT-2/LYPLA2 is the protein thioesterase involved in the acylation/deacylation cycle operating in GAP-43 subcellular distribution.

References
  • Satou M, et al. (2010) Identification and characterization of acyl-protein thioesterase 1/lysophospholipase I as a ghrelin deacylation/lysophospholipid hydrolyzing enzyme in fetal bovine serum and conditioned medium. Endocrinology. 151(10): 4765-75.
  • Tomatis VM, et al. (2010) Acyl-protein thioesterase 2 catalyzes the deacylation of peripheral membrane-associated GAP-43. PLoS One. 5(11): e15045.
  • Size / Price
    Catalog: MG52835-CM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"