LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52205-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LYPLA1/lysophospholipase I Reagents
CRO Services
Product recommended

All LYPLA1/lysophospholipase I Reagents
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
693 bp
Description
Full length Clone DNA of Mouse lysophospholipase 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Pla1a cDNA ORF Clone, Mouse
LYPLA1/lysophospholipase I Background Information
Full Name
lysophospholipase I

LYPLA1/lysophospholipase I cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LYPLA1/lysophospholipase I cDNA ORF Clone in Cloning Vector, Rat RG84074-U
LYPLA1/lysophospholipase I Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG84074-ACGLN

LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LYPLA1/lysophospholipase I cDNA ORF Clone in Cloning Vector, Mouse MG52205-G
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, untagged MG52205-UT
LYPLA1/lysophospholipase I Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52205-ACGLN
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52205-ACG
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52205-ANG
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52205-ACR
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52205-ANR
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52205-CF
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52205-NF
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, C-His tag MG52205-CH
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-His tag MG52205-NH
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, C-HA tag MG52205-CY
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, C-Myc tag MG52205-CM
LYPLA1/lysophospholipase I cDNA ORF Clone, Mouse, N-Myc tag MG52205-NM
LYPLA1/lysophospholipase I qPCR Primer Pairs, Mouse MP202078

LYPLA1/lysophospholipase I cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LYPLA1/lysophospholipase I cDNA ORF Clone, Human, untagged HG12359-UT
LYPLA1/lysophospholipase I Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12359-ACGLN
LYPLA1/lysophospholipase I qPCR Primer Pairs, Human HP104724
info info
添加购物车成功! 添加购物车失败!