LTV1 cDNA ORF Clone, Mouse, untagged

Cat: MG51631-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LTV1 Reagents
CRO Services
Product recommended

All LTV1 Reagents
LTV1 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Description
Full length Clone DNA of Mouse LTV1 homolog (S. cerevisiae).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LTV1 cDNA ORF Clone, Mouse, untagged Alternative Names
2610020N02Rik cDNA ORF Clone, Mouse
LTV1 Background Information
Full Name
LTV1 ribosome biogenesis factor

LTV1 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LTV1 cDNA ORF Clone in Cloning Vector, Rat RG8A0912-U
LTV1 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG8A0912-ACGLN

LTV1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LTV1 cDNA ORF Clone in Cloning Vector, Mouse MG51631-U
LTV1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51631-ACG
LTV1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51631-ACGLN
LTV1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51631-ANG
LTV1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51631-ACR
LTV1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51631-ANR
LTV1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51631-CF
LTV1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51631-NF
LTV1 cDNA ORF Clone, Mouse, C-His tag MG51631-CH
LTV1 cDNA ORF Clone, Mouse, N-His tag MG51631-NH
LTV1 cDNA ORF Clone, Mouse, C-HA tag MG51631-CY
LTV1 cDNA ORF Clone, Mouse, N-HA tag MG51631-NY
LTV1 cDNA ORF Clone, Mouse, C-Myc tag MG51631-CM
LTV1 cDNA ORF Clone, Mouse, N-Myc tag MG51631-NM
LTV1 qPCR Primer Pairs, Mouse MP201504

LTV1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LTV1 cDNA ORF Clone in Cloning Vector, Human HG16477-G
LTV1 cDNA ORF Clone, Human, untagged HG16477-UT
LTV1 cDNA ORF Clone, Human, C-GFPSpark® tag HG16477-ACG
LTV1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16477-ACGLN
LTV1 cDNA ORF Clone, Human, N-GFPSpark® tag HG16477-ANG
LTV1 cDNA ORF Clone, Human, C-OFPSpark® tag HG16477-ACR
LTV1 cDNA ORF Clone, Human, N-OFPSpark® tag HG16477-ANR
LTV1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16477-CF
LTV1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16477-NF
LTV1 cDNA ORF Clone, Human, C-His tag HG16477-CH
LTV1 cDNA ORF Clone, Human, N-His tag HG16477-NH
LTV1 cDNA ORF Clone, Human, C-HA tag HG16477-CY
LTV1 cDNA ORF Clone, Human, N-HA tag HG16477-NY
LTV1 cDNA ORF Clone, Human, C-Myc tag HG16477-CM
LTV1 cDNA ORF Clone, Human, N-Myc tag HG16477-NM
LTV1 qPCR Primer Pairs, Human HP105221
info info
添加购物车成功! 添加购物车失败!