LTV1 cDNA ORF Clone, Mouse, N-Myc tag

Price:
Size:
Number:

LTV1 cDNA ORF Clone, Mouse, N-Myc tag: General Information

Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1413 bp
Description
Full length Clone DNA of Mouse LTV1 homolog (S. cerevisiae) with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

LTV1 cDNA ORF Clone, Mouse, N-Myc tag: Alternative Names

2610020N02Rik cDNA ORF Clone, Mouse

LTV1 Background Information

Full Name
LTV1 ribosome biogenesis factor
Add to Cart Successfully Add to Cart Failed Shopping cart is being updated, please wait