Quick Order

Mouse LTA4H ORF mammalian expression plasmid, N-His tag

DatasheetReviewsRelated ProductsProtocols
Mouse LTA4H cDNA Clone Product Information
NCBI RefSeq:NM_008517.2
RefSeq ORF Size:1836bp
cDNA Description:Full length Clone DNA of Mus musculus leukotriene A4 hydrolase with N terminal His tag.
Gene Synonym:Lta4h
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Mouse leukotriene A-4 hydrolase, also known as LTA-4 hydrolase, Leukotriene A (4) hydrolase, LTA4H and LTA4, is cytoplasm protein which belongs to the peptidase M1 family. LTA4H hydrolyzes an epoxide moiety of leukotriene A4 (LTA-4) to form leukotriene B4 (LTB-4). This enzyme also has some peptidase activity. The leukotrienes (LTs) are a class of structurally related lipid mediators involved in the development and maintenance of inflammatory and allergic reactions. In the biosynthesis of LTs, arachidonic acid was converted into the unstable intermediate epoxide LTA4, which may in turn be conjugated with glutathione to form the spasmogenic LTC4, or hydrolyzed into the proinflammatory lipid mediator LTB4 in a reaction catalyzed by Leukotriene A4 hydrolase (LTA4H). LTB4 is a classical chemoattractant of human neutrophils and triggers adherence and aggregation of leukocytes to vascular endothelium, and also modulates immune responses. As a bifunctional zinc metalloenzyme, LTA4H also exhibits an anion-dependant arginyl aminopeptidase activity of high efficiency and specificity in addition to its epoxide hydrolase activity. LTA4H is regarded as a therapeutic target for inflammation.

References
  • Mancini, JA. et al.,1995, Eur. J. Biochem. 231: 65-71.
  • Orning, L. et al., 1994, J. Biol. Chem. 269: 11269-73.
  • Rudberg, PC. et al., 2004, J. Biol. Chem. 279: 27376-82.
  • Qiu, H. et al., 2006, Proc. Natl. Acad. Sci. USA. 103: 8161-6.
  • All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"