LSP1 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52852-NY
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LSP1 Reagents
CRO Services
Product recommended

All LSP1 Reagents
LSP1 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
993 bp
Description
Full length Clone DNA of Mouse lymphocyte specific 1 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LSP1 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
Lsp-1 cDNA ORF Clone, Mouse;p50 cDNA ORF Clone, Mouse;pp52 cDNA ORF Clone, Mouse;WP34 cDNA ORF Clone, Mouse
LSP1 Background Information
Full Name
lymphocyte-specific protein 1

LSP1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LSP1 cDNA ORF Clone in Cloning Vector, Mouse MG52852-G
LSP1 cDNA ORF Clone, Mouse, untagged MG52852-UT
LSP1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52852-ACGLN
LSP1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52852-ACG
LSP1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52852-ANG
LSP1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52852-ACR
LSP1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52852-ANR
LSP1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52852-CF
LSP1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52852-NF
LSP1 cDNA ORF Clone, Mouse, C-His tag MG52852-CH
LSP1 cDNA ORF Clone, Mouse, N-His tag MG52852-NH
LSP1 cDNA ORF Clone, Mouse, C-HA tag MG52852-CY
LSP1 cDNA ORF Clone, Mouse, C-Myc tag MG52852-CM
LSP1 cDNA ORF Clone, Mouse, N-Myc tag MG52852-NM

LSP1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LSP1 cDNA ORF Clone in Cloning Vector, Human HG14178-G
LSP1 cDNA ORF Clone, Human, untagged HG14178-UT
LSP1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14178-ACGLN
LSP1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14178-ACG
LSP1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14178-ANG
LSP1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14178-ACR
LSP1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14178-ANR
LSP1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14178-CF
LSP1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14178-NF
LSP1 cDNA ORF Clone, Human, C-His tag HG14178-CH
LSP1 cDNA ORF Clone, Human, N-His tag HG14178-NH
LSP1 cDNA ORF Clone, Human, C-HA tag HG14178-CY
LSP1 cDNA ORF Clone, Human, N-HA tag HG14178-NY
LSP1 cDNA ORF Clone, Human, C-Myc tag HG14178-CM
LSP1 cDNA ORF Clone, Human, N-Myc tag HG14178-NM
LSP1 qPCR Primer Pairs, Human HP102829
info info
添加购物车成功! 添加购物车失败!