LRRC59 cDNA ORF Clone, Mouse, untagged

Cat: MG52496-UT
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LRRC59 Reagents
CRO Services
Product recommended

All LRRC59 Reagents
LRRC59 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
924 bp
Description
Full length Clone DNA of Mouse leucine rich repeat containing 59.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRRC59 cDNA ORF Clone, Mouse, untagged Alternative Names
AA959742 cDNA ORF Clone, Mouse;C78668 cDNA ORF Clone, Mouse
LRRC59 Background Information
Full Name
leucine rich repeat containing 59

LRRC59 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LRRC59 cDNA ORF Clone in Cloning Vector, Mouse MG52496-G
LRRC59 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52496-ACG
LRRC59 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52496-ACGLN
LRRC59 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52496-ACR
LRRC59 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52496-CF
LRRC59 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52496-NF
LRRC59 cDNA ORF Clone, Mouse, C-His tag MG52496-CH
LRRC59 cDNA ORF Clone, Mouse, N-His tag MG52496-NH
LRRC59 cDNA ORF Clone, Mouse, C-HA tag MG52496-CY
LRRC59 cDNA ORF Clone, Mouse, N-HA tag MG52496-NY
LRRC59 cDNA ORF Clone, Mouse, C-Myc tag MG52496-CM
LRRC59 cDNA ORF Clone, Mouse, N-Myc tag MG52496-NM
LRRC59 qPCR Primer Pairs, Mouse MP202369

LRRC59 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LRRC59 cDNA ORF Clone in Cloning Vector, Human HG17202-U
LRRC59 cDNA ORF Clone, Human, untagged HG17202-UT
LRRC59 cDNA ORF Clone, Human, C-GFPSpark® tag HG17202-ACG
LRRC59 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG17202-ACGLN
LRRC59 cDNA ORF Clone, Human, C-OFPSpark® tag HG17202-ACR
LRRC59 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG17202-CF
LRRC59 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG17202-NF
LRRC59 cDNA ORF Clone, Human, C-His tag HG17202-CH
LRRC59 cDNA ORF Clone, Human, N-His tag HG17202-NH
LRRC59 cDNA ORF Clone, Human, C-HA tag HG17202-CY
LRRC59 cDNA ORF Clone, Human, N-HA tag HG17202-NY
LRRC59 cDNA ORF Clone, Human, C-Myc tag HG17202-CM
LRRC59 cDNA ORF Clone, Human, N-Myc tag HG17202-NM
info info
添加购物车成功! 添加购物车失败!