Text Size:AAA

Mouse LRRC59 Gene ORF cDNA clone expression plasmid

    DatasheetReviewsRelated ProductsProtocols
    Mouse LRRC59 cDNA Clone Product Information
    NCBI RefSeq:NM_133807.1
    RefSeq ORF Size:924bp
    cDNA Description:Full length Clone DNA of Mouse leucine rich repeat containing 59.
    Gene Synonym:C78668, AA959742, RP23-290B5.2
    Species:Mouse
    Vector:pCMV3-untagged
    Plasmid:
    Restriction Site:
    Tag Sequence:
    Sequence Description:
    Sequencing primers:T7( 5' TAATACGACTCACTATAGGG 3' )
    BGH( 5' TAGAAGGCACAGTCGAGG 3' )
    ( We provide with LRRC59 qPCR primers for gene expression analysis, MP202369 )
    Promoter:Enhanced CMV cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Ampicillin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Product nameProduct name
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"