LRRC14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG53047-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LRRC14 Reagents
CRO Services
Product recommended

All LRRC14 Reagents
LRRC14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1482 bp
Description
Full length Clone DNA of Mouse leucine rich repeat containing 14 with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LRRC14 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
E130306I01Rik cDNA ORF Clone, Mouse;mKIAA0014 cDNA ORF Clone, Mouse
LRRC14 Background Information
Full Name
leucine rich repeat containing 14

LRRC14 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LRRC14 cDNA ORF Clone in Cloning Vector, Mouse MG53047-G
LRRC14 cDNA ORF Clone, Mouse, untagged MG53047-UT
LRRC14 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53047-ACG
LRRC14 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG53047-ACGLN
LRRC14 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG53047-ANG
LRRC14 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG53047-ACR
LRRC14 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG53047-ANR
LRRC14 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG53047-CF
LRRC14 cDNA ORF Clone, Mouse, C-His tag MG53047-CH
LRRC14 cDNA ORF Clone, Mouse, N-His tag MG53047-NH
LRRC14 cDNA ORF Clone, Mouse, C-HA tag MG53047-CY
LRRC14 cDNA ORF Clone, Mouse, N-HA tag MG53047-NY
LRRC14 cDNA ORF Clone, Mouse, C-Myc tag MG53047-CM
LRRC14 cDNA ORF Clone, Mouse, N-Myc tag MG53047-NM

LRRC14 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LRRC14 cDNA ORF Clone in Cloning Vector, Human HG13569-G
LRRC14 cDNA ORF Clone, Human, untagged HG13569-UT
LRRC14 cDNA ORF Clone, Human, C-GFPSpark® tag HG13569-ACG
LRRC14 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13569-ACGLN
LRRC14 cDNA ORF Clone, Human, N-GFPSpark® tag HG13569-ANG
LRRC14 cDNA ORF Clone, Human, C-OFPSpark® tag HG13569-ACR
LRRC14 cDNA ORF Clone, Human, N-OFPSpark® tag HG13569-ANR
LRRC14 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13569-CF
LRRC14 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13569-NF
LRRC14 cDNA ORF Clone, Human, C-His tag HG13569-CH
LRRC14 cDNA ORF Clone, Human, N-His tag HG13569-NH
LRRC14 cDNA ORF Clone, Human, C-HA tag HG13569-CY
LRRC14 cDNA ORF Clone, Human, N-HA tag HG13569-NY
LRRC14 cDNA ORF Clone, Human, C-Myc tag HG13569-CM
LRRC14 cDNA ORF Clone, Human, N-Myc tag HG13569-NM
LRRC14 qPCR Primer Pairs, Human HP102255
info info
添加购物车成功! 添加购物车失败!