LMO4 cDNA ORF Clone, Mouse, C-Myc tag

Cat: MG51875-CM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LMO4 Reagents
CRO Services
Product recommended

All LMO4 Reagents
LMO4 cDNA ORF Clone, Mouse, C-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
498 bp
Description
Full length Clone DNA of Mouse LIM domain only 4 with C terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LMO4 cDNA ORF Clone, Mouse, C-Myc tag Alternative Names
A730077C12Rik cDNA ORF Clone, Mouse;Crp3 cDNA ORF Clone, Mouse;Etohi4 cDNA ORF Clone, Mouse
LMO4 Background Information
Full Name
LIM domain only 4

LMO4 cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LMO4 cDNA ORF Clone in Cloning Vector, Rat RG86876-U
LMO4 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG86876-ACGLN

LMO4 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LMO4 cDNA ORF Clone in Cloning Vector, Mouse MG51875-U
LMO4 cDNA ORF Clone, Mouse, untagged MG51875-UT
LMO4 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51875-ACGLN
LMO4 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51875-ACG
LMO4 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51875-ANG
LMO4 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51875-ACR
LMO4 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51875-ANR
LMO4 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51875-CF
LMO4 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51875-NF
LMO4 cDNA ORF Clone, Mouse, C-His tag MG51875-CH
LMO4 cDNA ORF Clone, Mouse, N-His tag MG51875-NH
LMO4 cDNA ORF Clone, Mouse, C-HA tag MG51875-CY
LMO4 cDNA ORF Clone, Mouse, N-HA tag MG51875-NY
LMO4 cDNA ORF Clone, Mouse, N-Myc tag MG51875-NM
LMO4 qPCR Primer Pairs, Mouse MP201748

LMO4 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LMO4 cDNA ORF Clone in Cloning Vector, Human HG13876-G
LMO4 cDNA ORF Clone, Human, untagged HG13876-UT
LMO4 cDNA ORF Clone, Human, C-GFPSpark® tag HG13876-ACG
LMO4 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG13876-ACGLN
LMO4 cDNA ORF Clone, Human, N-GFPSpark® tag HG13876-ANG
LMO4 cDNA ORF Clone, Human, C-OFPSpark® tag HG13876-ACR
LMO4 cDNA ORF Clone, Human, N-OFPSpark® tag HG13876-ANR
LMO4 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG13876-CF
LMO4 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG13876-NF
LMO4 cDNA ORF Clone, Human, C-His tag HG13876-CH
LMO4 cDNA ORF Clone, Human, N-His tag HG13876-NH
LMO4 cDNA ORF Clone, Human, C-HA tag HG13876-CY
LMO4 cDNA ORF Clone, Human, N-HA tag HG13876-NY
LMO4 cDNA ORF Clone, Human, C-Myc tag HG13876-CM
LMO4 cDNA ORF Clone, Human, N-Myc tag HG13876-NM
LMO4 qPCR Primer Pairs, Human HP102547
info info
添加购物车成功! 添加购物车失败!