LIX1L cDNA ORF Clone, Mouse, N-Myc tag

Cat: MG51599-NM
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LIX1L Reagents
CRO Services
Product recommended

All LIX1L Reagents
LIX1L cDNA ORF Clone, Mouse, N-Myc tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1014 bp
Description
Full length Clone DNA of Mouse Lix1-like with N terminal Myc tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-Myc
Tag Sequence
Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LIX1L cDNA ORF Clone, Mouse, N-Myc tag Alternative Names
D130027M04Rik cDNA ORF Clone, Mouse
LIX1L Background Information
Full Name
Lix1 homolog (chicken) like

LIX1L cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LIX1L cDNA ORF Clone in Cloning Vector, Mouse MG51599-G
LIX1L cDNA ORF Clone, Mouse, untagged MG51599-UT
LIX1L Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51599-ACGLN
LIX1L cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51599-ACG
LIX1L cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51599-ANG
LIX1L cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51599-ACR
LIX1L cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51599-ANR
LIX1L cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG51599-CF
LIX1L cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51599-NF
LIX1L cDNA ORF Clone, Mouse, C-His tag MG51599-CH
LIX1L cDNA ORF Clone, Mouse, N-His tag MG51599-NH
LIX1L cDNA ORF Clone, Mouse, C-HA tag MG51599-CY
LIX1L cDNA ORF Clone, Mouse, N-HA tag MG51599-NY
LIX1L cDNA ORF Clone, Mouse, C-Myc tag MG51599-CM
LIX1L qPCR Primer Pairs, Mouse MP201482

LIX1L cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LIX1L cDNA ORF Clone in Cloning Vector, Human HG28896-U
LIX1L cDNA ORF Clone, Human, untagged HG28896-UT
LIX1L cDNA ORF Clone, Human, C-GFPSpark® tag HG28896-ACG
LIX1L Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG28896-ACGLN
LIX1L cDNA ORF Clone, Human, N-GFPSpark® tag HG28896-ANG
LIX1L cDNA ORF Clone, Human, C-OFPSpark® tag HG28896-ACR
LIX1L cDNA ORF Clone, Human, N-OFPSpark® tag HG28896-ANR
LIX1L cDNA ORF Clone, Human, C-DDK (Flag®) tag HG28896-CF
LIX1L cDNA ORF Clone, Human, N-DDK (Flag®) tag HG28896-NF
LIX1L cDNA ORF Clone, Human, C-His tag HG28896-CH
LIX1L cDNA ORF Clone, Human, N-His tag HG28896-NH
LIX1L cDNA ORF Clone, Human, C-HA tag HG28896-CY
LIX1L cDNA ORF Clone, Human, N-HA tag HG28896-NY
LIX1L cDNA ORF Clone, Human, C-Myc tag HG28896-CM
LIX1L cDNA ORF Clone, Human, N-Myc tag HG28896-NM
info info
添加购物车成功! 添加购物车失败!