LILRB3 cDNA ORF Clone, Mouse, N-His tag

Cat: MG50760-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LILRB3 Reagents
CRO Services
Product recommended

All LILRB3 Reagents
LILRB3 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2526 bp
Description
Full length Clone DNA of Mouse leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LILRB3 cDNA ORF Clone, Mouse, N-His tag Alternative Names
Gp91 cDNA ORF Clone, Mouse;Pirb cDNA ORF Clone, Mouse
LILRB3 Background Information

Leukocyte immunoglobulin-like receptor subfamily B member 3, also known as Leukocyte immunoglobulin-like receptor 3, Immunoglobulin-like transcript 5, Monocyte inhibitory receptor HL9, CD85 antigen-like family member A, CD85a and LILRB3, is a single-pass type I  membrane protein which belongs to the leukocyte receptor cluster (LRC) present on 19q13.4. LILRB3 / CD85a contains four Ig-like C2-type (immunoglobulin-like) domains. LILRB3 / CD85a contains three copies of a cytoplasmic motif that is referred to as the immunoreceptor tyrosine-based inhibitor motif (ITIM). This motif is involved in modulation of cellular responses. The phosphorylated ITIM motif can bind the SH2 domain of several SH2-containing phosphatases. LILRB3 / CD85a is expressed on immune cells where it binds to MHC class I molecules on antigen-presenting cells and transduces a negative signal that inhibits stimulation of an immune response. It is thought to control inflammatory responses and cytotoxicity to help focus the immune response and limit autoreactivity. Multiple transcript variants encoding different isoforms have been found.

Full Name
leukocyte immunoglobulin like receptor B3
References
  • Huang,J. et al., 2010, J Virol. 84 (18): 9463-71.
  • Arm J.P. et al., 1997, J. Immunol. 159:2342-2349.
  • Wende H. et al., 2000, Immunogenetics 51:703-713.
  • Yu L.-R. et al., 2007,J. Proteome Res. 6:4150-4162.
  • LILRB3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LILRB3 cDNA ORF Clone in Cloning Vector, Mouse MG50760-G
    LILRB3 cDNA ORF Clone, Mouse, untagged MG50760-UT
    LILRB3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50760-ACG
    LILRB3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50760-ACGLN
    LILRB3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50760-ACR
    LILRB3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50760-CF
    LILRB3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50760-NF
    LILRB3 cDNA ORF Clone, Mouse, C-His tag MG50760-CH
    LILRB3 cDNA ORF Clone, Mouse, C-HA tag MG50760-CY
    LILRB3 cDNA ORF Clone, Mouse, N-HA tag MG50760-NY
    LILRB3 cDNA ORF Clone, Mouse, C-Myc tag MG50760-CM
    LILRB3 cDNA ORF Clone, Mouse, N-Myc tag MG50760-NM
    LILRB3 qPCR Primer Pairs, Mouse MP200734

    LILRB3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LILRB3 cDNA ORF Clone in Cloning Vector, Human HG11978-M
    LILRB3 cDNA ORF Clone, Human, untagged HG11978-UT
    LILRB3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11978-ACGLN
    LILRB3 cDNA ORF Clone, Human, C-GFPSpark® tag HG11978-ACG
    LILRB3 cDNA ORF Clone, Human, C-OFPSpark® tag HG11978-ACR
    LILRB3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11978-CF
    LILRB3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11978-NF
    LILRB3 cDNA ORF Clone, Human, C-His tag HG11978-CH
    LILRB3 cDNA ORF Clone, Human, N-His tag HG11978-NH
    LILRB3 cDNA ORF Clone, Human, C-HA tag HG11978-CY
    LILRB3 cDNA ORF Clone, Human, N-HA tag HG11978-NY
    LILRB3 cDNA ORF Clone, Human, C-Myc tag HG11978-CM
    LILRB3 cDNA ORF Clone, Human, N-Myc tag HG11978-NM
    LILRB3 qPCR Primer Pairs, Human HP101523
    info info
    添加购物车成功! 添加购物车失败!