Legumain cDNA ORF Clone, Mouse, N-HA tag

Cat: MG50051-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Legumain Reagents
CRO Services
Product recommended

All Legumain Reagents
Legumain cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1308 bp
Description
Full length Clone DNA of Mouse legumain with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Legumain cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AEP cDNA ORF Clone, Mouse;AI746452 cDNA ORF Clone, Mouse;AU022324 cDNA ORF Clone, Mouse;Prsc1 cDNA ORF Clone, Mouse
Legumain Background Information

The Mammalian Legumain, also known as LGMN, also called asparaginyl endopeptidase (AEP), is a cysteine protease belonging to peptidase family C13 with a strict specificity for hydrolysis of asparaginyl bonds. Known previously only from plants and invertebrates, Legumain is discovered as a lysosomal endopeptidase in mammals. Mammalian Legumain is a cysteine endopeptidase, inhibited by iodoacetamide and maleimides, but unaffected by compound E64. The Mammalian Legumain is involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Legumain has been observed to be highly expressed in several types of solid tumors. It was demonstrated in membrane-associated vesicles concentrated at the invadopodia of tumor cells and on cell surfaces where it colocalized with integrins. Legumain was demonstrated to activate progelatinase A. Cells overexpressing Legumain possessed increased migratory and invasive activity in vitro and adopted an invasive and metastatic phenotype in vivo, inferring significance of Legumain in tumor invasion and metastasis. In addition, Legumain is expressed in both murine and human atherosclerotic lesions. The macrophage-specific expression of Legumain in vivo and ability of Legumain to induce chemotaxis of monocytes and endothelial cells in vitro suggest that Legumain may play a functional role in atherogenesis.

Full Name
legumain
References
  • Schwarz G, et al. (2002) Characterization of legumain. Biol Chem. 383(11): 1813-6.
  • Liu C, et al. (2003) Overexpression of legumain in tumors is significant for invasion/metastasis and a candidate enzymatic target for prodrug therapy. Cancer Res. 63(11): 2957-64.
  • Murthy RV, et al. (2005) Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer. Clin Cancer Res. 11(6): 2293-9.
  • Gawenda J, et al. (2007) Legumain expression as a prognostic factor in breast cancer patients. Breast Cancer Res Treat. 102(1): 1-6.
  • Clerin V, et al. (2007) Expression of the cysteine protease legumain in vascular lesions and functional implications in atherogenesis. Atherosclerosis. 201(1): 53-66.
  • Lew?“n S, et al. (2008) A Legumain-based minigene vaccine targets the tumor stroma and suppresses breast cancer growth and angiogenesis. Cancer Immunol Immunother. 57(4): 507-15.
  • Legumain cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Legumain cDNA ORF Clone in Cloning Vector, Rat RG81209-U
    Legumain cDNA ORF Clone, Rat, untagged RG81209-UT
    Legumain Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG81209-ACGLN
    Legumain cDNA ORF Clone, Rat, C-GFPSpark® tag RG81209-ACG
    Legumain cDNA ORF Clone, Rat, C-OFPSpark® tag RG81209-ACR
    Legumain cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG81209-CF
    Legumain cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG81209-NF
    Legumain cDNA ORF Clone, Rat, C-His tag RG81209-CH
    Legumain cDNA ORF Clone, Rat, N-His tag RG81209-NH
    Legumain cDNA ORF Clone, Rat, C-HA tag RG81209-CY
    Legumain cDNA ORF Clone, Rat, N-HA tag RG81209-NY
    Legumain cDNA ORF Clone, Rat, C-Myc tag RG81209-CM
    Legumain cDNA ORF Clone, Rat, N-Myc tag RG81209-NM
    Legumain qPCR Primer Pairs, Rat RP301165

    Legumain cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Legumain cDNA ORF Clone in Cloning Vector, Mouse MG50051-M
    Legumain cDNA ORF Clone, Mouse, untagged MG50051-UT
    Legumain Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50051-ACGLN
    Legumain cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50051-ACG
    Legumain cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50051-ACR
    Legumain cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50051-CF
    Legumain cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50051-NF
    Legumain cDNA ORF Clone, Mouse, C-His tag MG50051-CH
    Legumain cDNA ORF Clone, Mouse, N-His tag MG50051-NH
    Legumain cDNA ORF Clone, Mouse, C-HA tag MG50051-CY
    Legumain cDNA ORF Clone, Mouse, C-Myc tag MG50051-CM
    Legumain cDNA ORF Clone, Mouse, N-Myc tag MG50051-NM
    Legumain qPCR Primer Pairs, Mouse MP200051

    Legumain cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Legumain cDNA ORF Clone in Cloning Vector, Human HG12846-G
    Legumain cDNA ORF Clone, Human, untagged HG12846-UT
    Legumain cDNA ORF Clone, Human, C-GFPSpark® tag HG12846-ACG
    Legumain Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG12846-ACGLN
    Legumain cDNA ORF Clone, Human, N-GFPSpark® tag HG12846-ANG
    Legumain cDNA ORF Clone, Human, C-OFPSpark® tag HG12846-ACR
    Legumain cDNA ORF Clone, Human, N-OFPSpark® tag HG12846-ANR
    Legumain cDNA ORF Clone, Human, C-DDK (Flag®) tag HG12846-CF
    Legumain cDNA ORF Clone, Human, N-DDK (Flag®) tag HG12846-NF
    Legumain cDNA ORF Clone, Human, C-His tag HG12846-CH
    Legumain cDNA ORF Clone, Human, N-His tag HG12846-NH
    Legumain cDNA ORF Clone, Human, C-HA tag HG12846-CY
    Legumain cDNA ORF Clone, Human, N-HA tag HG12846-NY
    Legumain cDNA ORF Clone, Human, C-Myc tag HG12846-CM
    Legumain cDNA ORF Clone, Human, N-Myc tag HG12846-NM
    Legumain qPCR Primer Pairs, Human HP103202
    info info
    添加购物车成功! 添加购物车失败!