Quick Order

Mouse Legumain Gene ORF cDNA clone expression plasmid, N-HA tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse LGMN cDNA Clone Product Information
    NCBI RefSeq:NM_011175.2
    RefSeq ORF Size:1308bp
    cDNA Description:Full length Clone DNA of Mus musculus legumain with C terminal HA tag.
    Gene Synonym:AEP, Prsc1, AI746452, AU022324, Lgmn
    Species:Mouse
    Vector:pCMV3-SP-N-HA
    Plasmid:
    Restriction Site:
    Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LGMN qPCR primers for gene expression analysis, MP200051 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    HA Tag Info

    Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

    The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

    Product nameProduct name
    Background

    The Mammalian Legumain, also known as LGMN, also called asparaginyl endopeptidase (AEP), is a cysteine protease belonging to peptidase family C13 with a strict specificity for hydrolysis of asparaginyl bonds. Known previously only from plants and invertebrates, Legumain is discovered as a lysosomal endopeptidase in mammals. Mammalian Legumain is a cysteine endopeptidase, inhibited by iodoacetamide and maleimides, but unaffected by compound E64. The Mammalian Legumain is involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Legumain has been observed to be highly expressed in several types of solid tumors. It was demonstrated in membrane-associated vesicles concentrated at the invadopodia of tumor cells and on cell surfaces where it colocalized with integrins. Legumain was demonstrated to activate progelatinase A. Cells overexpressing Legumain possessed increased migratory and invasive activity in vitro and adopted an invasive and metastatic phenotype in vivo, inferring significance of Legumain in tumor invasion and metastasis. In addition, Legumain is expressed in both murine and human atherosclerotic lesions. The macrophage-specific expression of Legumain in vivo and ability of Legumain to induce chemotaxis of monocytes and endothelial cells in vitro suggest that Legumain may play a functional role in atherogenesis.

    References
  • Schwarz G, et al. (2002) Characterization of legumain. Biol Chem. 383(11): 1813-6.
  • Liu C, et al. (2003) Overexpression of legumain in tumors is significant for invasion/metastasis and a candidate enzymatic target for prodrug therapy. Cancer Res. 63(11): 2957-64.
  • Murthy RV, et al. (2005) Legumain expression in relation to clinicopathologic and biological variables in colorectal cancer. Clin Cancer Res. 11(6): 2293-9.
  • Gawenda J, et al. (2007) Legumain expression as a prognostic factor in breast cancer patients. Breast Cancer Res Treat. 102(1): 1-6.
  • Clerin V, et al. (2007) Expression of the cysteine protease legumain in vascular lesions and functional implications in atherogenesis. Atherosclerosis. 201(1): 53-66.
  • Lew?“n S, et al. (2008) A Legumain-based minigene vaccine targets the tumor stroma and suppresses breast cancer growth and angiogenesis. Cancer Immunol Immunother. 57(4): 507-15.
  • Size / Price
    Catalog: MG50051-NY
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"