Galectin 8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG50429-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Galectin 8 Reagents
CRO Services
Product recommended

All Galectin 8 Reagents
Galectin 8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
951 bp
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 8 with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin 8 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
1200015E08Rik cDNA ORF Clone, Mouse;AI326142 cDNA ORF Clone, Mouse;D13Ertd524e cDNA ORF Clone, Mouse;Lgals-8 cDNA ORF Clone, Mouse
Galectin 8 Background Information
Full Name
lectin, galactoside-binding, soluble, 8
References
  • Levy Y, et al. (2003) Sustained induction of ERK, protein kinase B, and p70 S6 kinase regulates cell spreading and formation of F-actin microspikes upon ligation of integrins by galectin-8, a mammalian lectin. J Biol Chem. 278(16):14533-42.
  • Nishi N, et al. (2003) Galectin-8 modulates neutrophil function via interaction with integrin alphaM. Glycobiology. 13(11):755-63.
  • Bidon-Wagner N, et al. (2004) Human galectin-8 isoforms and cancer. Glycoconj J. 19(7-9):557-63.
  • Galectin 8 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Galectin 8 cDNA ORF Clone in Cloning Vector, Rhesus CG90167-G
    Galectin 8 cDNA ORF Clone, Rhesus, untagged CG90167-UT
    Galectin 8 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90167-ACGLN
    Galectin 8 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90167-ACG
    Galectin 8 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90167-ANG
    Galectin 8 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90167-ACR
    Galectin 8 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90167-ANR
    Galectin 8 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90167-CF
    Galectin 8 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90167-NF
    Galectin 8 cDNA ORF Clone, Rhesus, C-His tag CG90167-CH
    Galectin 8 cDNA ORF Clone, Rhesus, N-His tag CG90167-NH
    Galectin 8 cDNA ORF Clone, Rhesus, C-HA tag CG90167-CY
    Galectin 8 cDNA ORF Clone, Rhesus, N-HA tag CG90167-NY
    Galectin 8 cDNA ORF Clone, Rhesus, C-Myc tag CG90167-CM
    Galectin 8 cDNA ORF Clone, Rhesus, N-Myc tag CG90167-NM

    Galectin 8 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Galectin 8 cDNA ORF Clone in Cloning Vector, Rat RG80231-G
    Galectin 8 cDNA ORF Clone, Rat, untagged RG80231-UT
    Galectin 8 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80231-ACGLN
    Galectin 8 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80231-ACG
    Galectin 8 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80231-ANG
    Galectin 8 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80231-ACR
    Galectin 8 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80231-ANR
    Galectin 8 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80231-CF
    Galectin 8 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80231-NF
    Galectin 8 cDNA ORF Clone, Rat, C-His tag RG80231-CH
    Galectin 8 cDNA ORF Clone, Rat, N-His tag RG80231-NH
    Galectin 8 cDNA ORF Clone, Rat, C-HA tag RG80231-CY
    Galectin 8 cDNA ORF Clone, Rat, N-HA tag RG80231-NY
    Galectin 8 cDNA ORF Clone, Rat, C-Myc tag RG80231-CM
    Galectin 8 cDNA ORF Clone, Rat, N-Myc tag RG80231-NM
    Galectin 8 qPCR Primer Pairs, Rat RP300387

    Galectin 8 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Galectin 8 cDNA ORF Clone in Cloning Vector, Mouse MG50429-M
    Galectin 8 cDNA ORF Clone, Mouse, untagged MG50429-UT
    Galectin 8 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50429-ACGLN
    Galectin 8 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50429-ACG
    Galectin 8 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50429-ANG
    Galectin 8 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50429-ACR
    Galectin 8 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50429-ANR
    Galectin 8 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50429-NF
    Galectin 8 cDNA ORF Clone, Mouse, C-His tag MG50429-CH
    Galectin 8 cDNA ORF Clone, Mouse, N-His tag MG50429-NH
    Galectin 8 cDNA ORF Clone, Mouse, C-HA tag MG50429-CY
    Galectin 8 cDNA ORF Clone, Mouse, N-HA tag MG50429-NY
    Galectin 8 cDNA ORF Clone, Mouse, C-Myc tag MG50429-CM
    Galectin 8 cDNA ORF Clone, Mouse, N-Myc tag MG50429-NM
    Galectin 8 qPCR Primer Pairs, Mouse MP200439

    Galectin 8 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Galectin 8 cDNA ORF Clone in Cloning Vector, Human HG10301-M
    Galectin 8 cDNA ORF Clone, Human, untagged HG10301-UT
    Galectin 8 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10301-ACGLN
    Galectin 8 cDNA ORF Clone, Human, C-GFPSpark® tag HG10301-ACG
    Galectin 8 cDNA ORF Clone, Human, N-GFPSpark® tag HG10301-ANG
    Galectin 8 cDNA ORF Clone, Human, C-OFPSpark® tag HG10301-ACR
    Galectin 8 cDNA ORF Clone, Human, N-OFPSpark® tag HG10301-ANR
    Galectin 8 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10301-CF
    Galectin 8 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10301-NF
    Galectin 8 cDNA ORF Clone, Human, C-His tag HG10301-CH
    Galectin 8 cDNA ORF Clone, Human, N-His tag HG10301-NH
    Galectin 8 cDNA ORF Clone, Human, C-HA tag HG10301-CY
    Galectin 8 cDNA ORF Clone, Human, N-HA tag HG10301-NY
    Galectin 8 cDNA ORF Clone, Human, C-Myc tag HG10301-CM
    Galectin 8 cDNA ORF Clone, Human, N-Myc tag HG10301-NM
    Galectin 8 qPCR Primer Pairs, Human HP100344
    info info
    添加购物车成功! 添加购物车失败!