LGALS3BP cDNA ORF Clone, Mouse, C-His tag

Cat: MG50614-CH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LGALS3BP Reagents
CRO Services
Product recommended

All LGALS3BP Reagents
LGALS3BP cDNA ORF Clone, Mouse, C-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1734 bp
Description
Full length Clone DNA of Mouse lectin, galactoside-binding, soluble, 3 binding protein with C terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LGALS3BP cDNA ORF Clone, Mouse, C-His tag Alternative Names
90K cDNA ORF Clone, Mouse;CyCAP cDNA ORF Clone, Mouse;MAC-2BP cDNA ORF Clone, Mouse;Ppicap cDNA ORF Clone, Mouse;Tango10b cDNA ORF Clone, Mouse
LGALS3BP Background Information
Full Name
lectin, galactoside-binding, soluble, 3 binding protein

LGALS3BP cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LGALS3BP cDNA ORF Clone in Cloning Vector, Mouse MG50614-M
LGALS3BP cDNA ORF Clone, Mouse, untagged MG50614-UT
LGALS3BP Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50614-ACGLN
LGALS3BP cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50614-ACG
LGALS3BP cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50614-ACR
LGALS3BP cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50614-CF
LGALS3BP cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50614-NF
LGALS3BP cDNA ORF Clone, Mouse, N-His tag MG50614-NH
LGALS3BP cDNA ORF Clone, Mouse, C-HA tag MG50614-CY
LGALS3BP cDNA ORF Clone, Mouse, N-HA tag MG50614-NY
LGALS3BP cDNA ORF Clone, Mouse, C-Myc tag MG50614-CM
LGALS3BP cDNA ORF Clone, Mouse, N-Myc tag MG50614-NM
LGALS3BP qPCR Primer Pairs, Mouse MP200599

LGALS3BP cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LGALS3BP cDNA ORF Clone in Cloning Vector, Human HG10300-M
LGALS3BP cDNA ORF Clone, Human, untagged HG10300-UT
LGALS3BP cDNA ORF Clone, Human, C-GFPSpark® tag HG10300-ACG
LGALS3BP Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10300-ACGLN
LGALS3BP cDNA ORF Clone, Human, C-OFPSpark® tag HG10300-ACR
LGALS3BP cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10300-CF
LGALS3BP cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10300-NF
LGALS3BP cDNA ORF Clone, Human, C-His tag HG10300-CH
LGALS3BP cDNA ORF Clone, Human, N-His tag HG10300-NH
LGALS3BP cDNA ORF Clone, Human, C-HA tag HG10300-CY
LGALS3BP cDNA ORF Clone, Human, N-HA tag HG10300-NY
LGALS3BP cDNA ORF Clone, Human, C-Myc tag HG10300-CM
LGALS3BP cDNA ORF Clone, Human, N-Myc tag HG10300-NM
LGALS3BP qPCR Primer Pairs, Human HP100343
info info
添加购物车成功! 添加购物车失败!