Galectin-3 cDNA ORF Clone, Mouse, untagged

Cat: MG50406-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All Galectin-3 Reagents
CRO Services
Product recommended

All Galectin-3 Reagents
Galectin-3 cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
795 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117T/C, 132C/T, 141A/G, 186C/T, 546G/A and 627C/A not causing the amino acid variation.
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 3.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Restriction Sites
KpnI + NotI (6.1kb + 0.8kb)
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
Galectin-3 cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-3 cDNA ORF Clone, Mouse, untagged Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
Galectin-3 cDNA ORF Clone, Mouse, untagged Alternative Names
gal3 cDNA ORF Clone, Mouse;GBP cDNA ORF Clone, Mouse;L-34 cDNA ORF Clone, Mouse;Mac-2 cDNA ORF Clone, Mouse
Galectin-3 Background Information
Full Name
lectin, galactoside-binding, soluble, 3
References
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Galectin-3 cDNA ORF Clone, Rhesus, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Rhesus CG90166-G
    Galectin-3 cDNA ORF Clone, Rhesus, untagged CG90166-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90166-ACGLN
    Galectin-3 cDNA ORF Clone, Rhesus, C-GFPSpark® tag CG90166-ACG
    Galectin-3 cDNA ORF Clone, Rhesus, N-GFPSpark® tag CG90166-ANG
    Galectin-3 cDNA ORF Clone, Rhesus, C-OFPSpark® tag CG90166-ACR
    Galectin-3 cDNA ORF Clone, Rhesus, N-OFPSpark® tag CG90166-ANR
    Galectin-3 cDNA ORF Clone, Rhesus, C-DDK (Flag®) tag CG90166-CF
    Galectin-3 cDNA ORF Clone, Rhesus, N-DDK (Flag®) tag CG90166-NF
    Galectin-3 cDNA ORF Clone, Rhesus, C-His tag CG90166-CH
    Galectin-3 cDNA ORF Clone, Rhesus, N-His tag CG90166-NH
    Galectin-3 cDNA ORF Clone, Rhesus, C-HA tag CG90166-CY
    Galectin-3 cDNA ORF Clone, Rhesus, N-HA tag CG90166-NY
    Galectin-3 cDNA ORF Clone, Rhesus, C-Myc tag CG90166-CM
    Galectin-3 cDNA ORF Clone, Rhesus, N-Myc tag CG90166-NM

    Galectin-3 cDNA ORF Clone, Rat, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Rat RG80393-G
    Galectin-3 cDNA ORF Clone, Rat, untagged RG80393-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80393-ACGLN
    Galectin-3 cDNA ORF Clone, Rat, C-GFPSpark® tag RG80393-ACG
    Galectin-3 cDNA ORF Clone, Rat, N-GFPSpark® tag RG80393-ANG
    Galectin-3 cDNA ORF Clone, Rat, C-OFPSpark® tag RG80393-ACR
    Galectin-3 cDNA ORF Clone, Rat, N-OFPSpark® tag RG80393-ANR
    Galectin-3 cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80393-CF
    Galectin-3 cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80393-NF
    Galectin-3 cDNA ORF Clone, Rat, C-His tag RG80393-CH
    Galectin-3 cDNA ORF Clone, Rat, N-His tag RG80393-NH
    Galectin-3 cDNA ORF Clone, Rat, C-HA tag RG80393-CY
    Galectin-3 cDNA ORF Clone, Rat, N-HA tag RG80393-NY
    Galectin-3 cDNA ORF Clone, Rat, C-Myc tag RG80393-CM
    Galectin-3 cDNA ORF Clone, Rat, N-Myc tag RG80393-NM
    Galectin-3 qPCR Primer Pairs, Rat RP300359

    Galectin-3 cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Mouse MG50406-M
    Galectin-3 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50406-ACGLN
    Galectin-3 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50406-ACG
    Galectin-3 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50406-ANG
    Galectin-3 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50406-ACR
    Galectin-3 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50406-ANR
    Galectin-3 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50406-CF
    Galectin-3 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50406-NF
    Galectin-3 cDNA ORF Clone, Mouse, C-His tag MG50406-CH
    Galectin-3 cDNA ORF Clone, Mouse, N-His tag MG50406-NH
    Galectin-3 cDNA ORF Clone, Mouse, C-HA tag MG50406-CY
    Galectin-3 cDNA ORF Clone, Mouse, N-HA tag MG50406-NY
    Galectin-3 cDNA ORF Clone, Mouse, C-Myc tag MG50406-CM
    Galectin-3 cDNA ORF Clone, Mouse, N-Myc tag MG50406-NM
    Galectin-3 qPCR Primer Pairs, Mouse MP200423

    Galectin-3 cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    Galectin-3 cDNA ORF Clone in Cloning Vector, Human HG10289-G
    Galectin-3 cDNA ORF Clone, Human, untagged HG10289-UT
    Galectin-3 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10289-ACGLN
    Galectin-3 cDNA ORF Clone, Human, C-GFPSpark® tag HG10289-ACG
    Galectin-3 cDNA ORF Clone, Human, N-GFPSpark® tag HG10289-ANG
    Galectin-3 cDNA ORF Clone, Human, C-OFPSpark® tag HG10289-ACR
    Galectin-3 cDNA ORF Clone, Human, N-OFPSpark® tag HG10289-ANR
    Galectin-3 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10289-CF
    Galectin-3 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10289-NF
    Galectin-3 cDNA ORF Clone, Human, C-His tag HG10289-CH
    Galectin-3 cDNA ORF Clone, Human, N-His tag HG10289-NH
    Galectin-3 cDNA ORF Clone, Human, C-HA tag HG10289-CY
    Galectin-3 cDNA ORF Clone, Human, N-HA tag HG10289-NY
    Galectin-3 cDNA ORF Clone, Human, C-Myc tag HG10289-CM
    Galectin-3 cDNA ORF Clone, Human, N-Myc tag HG10289-NM
    Galectin-3 qPCR Primer Pairs, Human HP100334
    info info
    添加购物车成功! 添加购物车失败!