Quick Order

Mouse LGALS3 Gene ORF cDNA clone expression plasmid

DatasheetReviewsRelated ProductsProtocols
Mouse LGALS3 cDNA Clone Product Information
NCBI RefSeq:NM_010705.3
RefSeq ORF Size:795bp
cDNA Description:Full length Clone DNA of Mus musculus lectin, galactose binding, soluble 3.
Gene Synonym:GBP, L-34, gal3, Mac-2, Lgals3
Species:Mouse
Vector:pCMV3-untagged
Plasmid:pCMV3-mLGALS3
Restriction Site:KpnI + NotI (6.1kb + 0.8kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 117T/C, 132C/T, 141A/G, 186C/T, 546G/A and 627C/A not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Mouse LGALS3 Gene Plasmid Map
Mouse LGALS3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
Product nameProduct name
References
  • Dumic J, et al. (2006) Galectin-3: an open-ended story. Biochim Biophys Acta. 1760(4): 616-35.
  • Sharma UC, et al. (2004) Galectin-3 marks activated macrophages in failure-prone hypertrophied hearts and contributes to cardiac dysfunction. Circulation. 110(19): 3121-8.
  • Yan YP, et al. (2009) Galectin-3 mediates post-ischemic tissue remodeling. Brain Res. 1288: 116-24.
  • Size / Price
    Catalog: MG50406-UT
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    AvailabilityIn Stock
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
    • Mouse LGALS3 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"