Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-HA tag

Cat: MG52940-NY
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All Galectin-12/LGALS12 Reagents
CRO Services
Product recommended

All Galectin-12/LGALS12 Reagents
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-HA tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
945 bp
Description
Full length Clone DNA of Mouse lectin, galactose binding, soluble 12 with N terminal HA tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-HA
Tag Sequence
HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-HA tag Alternative Names
AW987437 cDNA ORF Clone, Mouse;Grip1 cDNA ORF Clone, Mouse
Galectin-12/LGALS12 Background Information
Full Name
lectin, galactoside-binding, soluble, 12

Galectin-12/LGALS12 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
Galectin-12/LGALS12 cDNA ORF Clone in Cloning Vector, Mouse MG52940-G
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, untagged MG52940-UT
Galectin-12/LGALS12 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52940-ACGLN
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52940-ACG
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52940-ANG
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52940-ACR
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52940-ANR
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52940-CF
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52940-NF
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-His tag MG52940-CH
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-His tag MG52940-NH
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-HA tag MG52940-CY
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, C-Myc tag MG52940-CM
Galectin-12/LGALS12 cDNA ORF Clone, Mouse, N-Myc tag MG52940-NM

Galectin-12/LGALS12 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
Galectin-12/LGALS12 cDNA ORF Clone in Cloning Vector, Human HG11135-M
Galectin-12/LGALS12 cDNA ORF Clone, Human, untagged HG11135-UT
Galectin-12/LGALS12 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG11135-ACGLN
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-GFPSpark® tag HG11135-ACG
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-GFPSpark® tag HG11135-ANG
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-OFPSpark® tag HG11135-ACR
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-OFPSpark® tag HG11135-ANR
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG11135-CF
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG11135-NF
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-His tag HG11135-CH
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-His tag HG11135-NH
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-HA tag HG11135-CY
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-HA tag HG11135-NY
Galectin-12/LGALS12 cDNA ORF Clone, Human, C-Myc tag HG11135-CM
Galectin-12/LGALS12 cDNA ORF Clone, Human, N-Myc tag HG11135-NM
Galectin-12/LGALS12 qPCR Primer Pairs, Human HP101045
info info
添加购物车成功! 添加购物车失败!