LDLR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag

Cat: MG50481-NF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LDLR Reagents
CRO Services
Product recommended

All LDLR Reagents
LDLR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
2589 bp
Description
Full length Clone DNA of Mouse low density lipoprotein receptor with N terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-FLAG
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LDLR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Validated Images
Mouse LDLR/LDL R/LDL Receptor Gene Expression validated Image 16560
The plasmid was transfected into 293H adherent cells with Sinofection reagent (Cat# STF02). After 48 h, Immunofluorescence staining of cells. Cells were fixed with 4% PFA, permeabilzed with 0.3% Triton X-100 in PBS, blocked with 10% serum, and incubated with Mouse anti-Flag Tag monoclonal antibody (CST#8146S) at 37℃ 1 hour. Then cells were stained with Goat Anti-mouse IgG secondary antibody. The fluorescent signal is detected by fluorescence microscope. Each expression experiment has negative control.
LDLR cDNA ORF Clone, Mouse, N-DDK (Flag®) tag Alternative Names
Hlb301 cDNA ORF Clone, Mouse
LDLR Background Information

LDL Receptor, also known as LDLR, is a mosaic protein which belongs to the Low density lipoprotein receptor gene family. The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. LDL Receptor consists of 840 amino acids (after removal of signal peptide) and mediates the endocytosis of cholesterol-rich LDL. Low density lipoprotein (LDL) is normally bound at the cell membrane and taken into the cell ending up in lysosomes where the protein is degraded and the cholesterol is made available for repression of microsomal enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG CoA) reductase, the rate-limiting step in cholesterol synthesis. At the same time, a reciprocal stimulation of cholesterol ester synthesis takes place. LDL Receptor is a cell-surface receptor that recognizes the apoprotein B100 which is embedded in the phospholipid outer layer of LDL particles. The receptor also recognizes the apoE protein found in chylomicron remnants and VLDL remnants.

Full Name
low density lipoprotein receptor
References
  • Yamamoto T, et al. (1984) The human LDL receptor: a cysteine-rich protein with multiple Alu sequences in its mRNA. Cell. 39(1): 27-38.
  • Mao B, et al. (2001) LDL-receptor-related protein 6 is a receptor for Dickkopf proteins. Nature. 411(6835): 321-5.
  • Pinson KI, et al. (2000) An LDL-receptor-related protein mediates Wnt signalling in mice. Nature. 407(6803): 535-8.
  • LDLR cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    LDLR cDNA ORF Clone in Cloning Vector, Mouse MG50481-M
    LDLR cDNA ORF Clone, Mouse, untagged MG50481-UT
    LDLR Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50481-ACGLN
    LDLR cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50481-ACG
    LDLR cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50481-ACR
    LDLR cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50481-CF
    LDLR cDNA ORF Clone, Mouse, C-His tag MG50481-CH
    LDLR cDNA ORF Clone, Mouse, N-His tag MG50481-NH
    LDLR cDNA ORF Clone, Mouse, C-HA tag MG50481-CY
    LDLR cDNA ORF Clone, Mouse, N-HA tag MG50481-NY
    LDLR cDNA ORF Clone, Mouse, C-Myc tag MG50481-CM
    LDLR cDNA ORF Clone, Mouse, N-Myc tag MG50481-NM
    LDLR qPCR Primer Pairs, Mouse MP200328

    LDLR cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    LDLR cDNA ORF Clone in Cloning Vector, Human HG10231-M
    LDLR cDNA ORF Clone, Human, untagged HG10231-UT
    LDLR cDNA ORF Clone, Human, C-GFPSpark® tag HG10231-ACG
    LDLR Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10231-ACGLN
    LDLR cDNA ORF Clone, Human, C-OFPSpark® tag HG10231-ACR
    LDLR cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10231-CF
    LDLR cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10231-NF
    LDLR cDNA ORF Clone, Human, C-His tag HG10231-CH
    LDLR cDNA ORF Clone, Human, N-His tag HG10231-NH
    LDLR cDNA ORF Clone, Human, C-HA tag HG10231-CY
    LDLR cDNA ORF Clone, Human, N-HA tag HG10231-NY
    LDLR cDNA ORF Clone, Human, C-Myc tag HG10231-CM
    LDLR cDNA ORF Clone, Human, N-Myc tag HG10231-NM
    LDLR qPCR Primer Pairs, Human HP100078
    info info
    添加购物车成功! 添加购物车失败!