LDHA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag

Cat: MG51207-CF
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All LDHA Reagents
CRO Services
Product recommended

All LDHA Reagents
LDHA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1038 bp
Sequence Description
Identical with the Gene Bank Ref. ID sequence.
Description
Full length Clone DNA of Mouse lactate dehydrogenase A with C terminal Flag tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-C-FLAG
Restriction Sites
KpnI + XbaI(6kb+1.04kb)
Tag Sequence
FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.
LDHA cDNA ORF Neucleotide Sequence and Amino Acid Sequence Information

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LDHA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Validated Images
other Green fluorescent protein / GFP Gene Plasmid Map 5609
LDHA cDNA ORF Clone, Mouse, C-DDK (Flag®) tag Alternative Names
l7R2 cDNA ORF Clone, Mouse;Ldh1 cDNA ORF Clone, Mouse;Ldhm cDNA ORF Clone, Mouse
LDHA Background Information
Full Name
lactate dehydrogenase A

LDHA cDNA ORF Clone, Rat, Related Products

Product Name Catalog#(PDF)
LDHA cDNA ORF Clone in Cloning Vector, Rat RG80664-U
LDHA cDNA ORF Clone, Rat, untagged RG80664-UT
LDHA cDNA ORF Clone, Rat, C-GFPSpark® tag RG80664-ACG
LDHA Lentiviral cDNA ORF Clone, Rat, C-GFPSpark® tag RG80664-ACGLN
LDHA cDNA ORF Clone, Rat, N-GFPSpark® tag RG80664-ANG
LDHA cDNA ORF Clone, Rat, C-OFPSpark® tag RG80664-ACR
LDHA cDNA ORF Clone, Rat, N-OFPSpark® tag RG80664-ANR
LDHA cDNA ORF Clone, Rat, C-DDK (Flag®) tag RG80664-CF
LDHA cDNA ORF Clone, Rat, N-DDK (Flag®) tag RG80664-NF
LDHA cDNA ORF Clone, Rat, C-His tag RG80664-CH
LDHA cDNA ORF Clone, Rat, N-His tag RG80664-NH
LDHA cDNA ORF Clone, Rat, C-HA tag RG80664-CY
LDHA cDNA ORF Clone, Rat, N-HA tag RG80664-NY
LDHA cDNA ORF Clone, Rat, C-Myc tag RG80664-CM
LDHA cDNA ORF Clone, Rat, N-Myc tag RG80664-NM
LDHA qPCR Primer Pairs, Rat RP300628

LDHA cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LDHA cDNA ORF Clone in Cloning Vector, Mouse MG51207-U
LDHA cDNA ORF Clone, Mouse, untagged MG51207-UT
LDHA Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51207-ACGLN
LDHA cDNA ORF Clone, Mouse, C-GFPSpark® tag MG51207-ACG
LDHA cDNA ORF Clone, Mouse, N-GFPSpark® tag MG51207-ANG
LDHA cDNA ORF Clone, Mouse, C-OFPSpark® tag MG51207-ACR
LDHA cDNA ORF Clone, Mouse, N-OFPSpark® tag MG51207-ANR
LDHA cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG51207-NF
LDHA cDNA ORF Clone, Mouse, C-His tag MG51207-CH
LDHA cDNA ORF Clone, Mouse, N-His tag MG51207-NH
LDHA cDNA ORF Clone, Mouse, C-HA tag MG51207-CY
LDHA cDNA ORF Clone, Mouse, N-HA tag MG51207-NY
LDHA cDNA ORF Clone, Mouse, C-Myc tag MG51207-CM
LDHA cDNA ORF Clone, Mouse, N-Myc tag MG51207-NM
LDHA qPCR Primer Pairs, Mouse MP201091

LDHA cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LDHA cDNA ORF Clone in Cloning Vector, Human HG16141-U
LDHA cDNA ORF Clone, Human, untagged HG16141-UT
LDHA cDNA ORF Clone, Human, C-GFPSpark® tag HG16141-ACG
LDHA Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG16141-ACGLN
LDHA cDNA ORF Clone, Human, N-GFPSpark® tag HG16141-ANG
LDHA cDNA ORF Clone, Human, C-OFPSpark® tag HG16141-ACR
LDHA cDNA ORF Clone, Human, N-OFPSpark® tag HG16141-ANR
LDHA cDNA ORF Clone, Human, C-DDK (Flag®) tag HG16141-CF
LDHA cDNA ORF Clone, Human, N-DDK (Flag®) tag HG16141-NF
LDHA cDNA ORF Clone, Human, C-His tag HG16141-CH
LDHA cDNA ORF Clone, Human, N-His tag HG16141-NH
LDHA cDNA ORF Clone, Human, C-HA tag HG16141-CY
LDHA cDNA ORF Clone, Human, N-HA tag HG16141-NY
LDHA cDNA ORF Clone, Human, C-Myc tag HG16141-CM
LDHA cDNA ORF Clone, Human, N-Myc tag HG16141-NM
LDHA qPCR Primer Pairs, Human HP100007
info info
添加购物车成功! 添加购物车失败!