Text Size:AAA

Mouse NGAL/LCN2/Lipocalin-2 Gene ORF cDNA clone expression plasmid, N-Myc tag

    DatasheetReviewsRelated ProductsProtocols
    Mouse LCN2 cDNA Clone Product Information
    NCBI RefSeq:NM_008491.1
    RefSeq ORF Size:603bp
    cDNA Description:Full length Clone DNA of Mus musculus lipocalin 2 with N terminal Myc tag.
    Gene Synonym:24p3, NGAL, AW212229, Lcn2
    Species:Mouse
    Vector:pCMV3-SP-N-Myc
    Plasmid:
    Restriction Site:
    Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
    Sequence Description:
    Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
    ( We provide with LCN2 qPCR primers for gene expression analysis, MP200060 )
    Promoter:Enhanced CMV mammalian cell promoter
    Application:Stable or Transient mammalian expression
    Antibiotic in E.coli:Kanamycin
    Antibiotic in mammalian cell:Hygromycin
    Shipping_carrier:Each tube contains lyophilized plasmid.
    Storage:The lyophilized plasmid can be stored at room temperature for three months.
    Myc Tag Info

    A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

    The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

    Product nameProduct name
    Background

    Lipocalin-2 (LCN2), also known as neutrophil gelatinase-associated lipocalin (NGAL), is a 25 kDa protein belonging to the lipocalin superfamily. It was initially found in activated neutrophils, however, many other cells, like kidney tubular cells, may produce NGAL in response to various insults. This protein is released from injured tubular cells after various damaging stimuli, is already known by nephrologists as one of the most promising biomarkers of incoming Acute Kidney Injury (AKI). Recent evidence also suggests its role as a biomarker in a variety of other renal and non-renal conditions. Moreover, recent studies seem to suggest a potential involvement of this factor also in the genesis and progression of chronic kidney diseases. NGAL is the first known mammalian protein which specifically binds organic molecules called siderophores, which are high-affinity iron chelators. NGAL, first known as an antibacterial factor of natural immunity, and an acute phase protein, is currently one of the most interesting and enigmatic proteins involved in the process of tumor development. acting as an intracellular iron carrier and protecting MMP9 from proteolytic degradation, NGAL has a clear pro-tumoral effect, as has already been observed in different tumors (e.g. breast, stomach, oesophagus, brain) in humans. In thyroid carcinomas, NGAL is strongly induced by NF-kB, an important factor involved both in tumor growth and in the link between chronic inflammation and neoplastic development. Thus, Lipocalin-2 (LCN2/NGAL) has been implicated in a variety of processes including cell differentiation, proliferation, survival and morphogenesis.

    References
  • Schmidt-Ott KM, et al. (2006) Neutrophil gelatinase-associated lipocalin-mediated iron traffic in kidney epithelia. Curr Opin Nephrol Hypertens. 15(4): 442-9.
  • Bolignano D, et al. (2010) Neutrophil gelatinase-associated lipocalin (NGAL) in human neoplasias: a new protein enters the scene. Cancer Lett. 288(1): 10-6.
  • Soni SS, et al. (2010) NGAL: a biomarker of acute kidney injury and other systemic conditions. Int Urol Nephrol. 42(1): 141-50.
  • Bolignano D, et al. (2010) From kidney to cardiovascular diseases: NGAL as a biomarker beyond the confines of nephrology. Eur J Clin Invest. 40(3): 273-6.
  • Size / Price
    Catalog: MG50060-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability
    Add to CartBulk Discount Inquiry

    Datasheet & Documentation

    Contact Us
      Recently Viewed Items
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"