LANCL1 cDNA ORF Clone, Mouse, N-His tag

Cat: MG52564-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All LANCL1 Reagents
CRO Services
Product recommended

All LANCL1 Reagents
LANCL1 cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1200 bp
Description
Full length Clone DNA of Mouse LanC (bacterial lantibiotic synthetase component C)-like 1 with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

LANCL1 cDNA ORF Clone, Mouse, N-His tag Alternative Names
AW124738 cDNA ORF Clone, Mouse;Gpr69 cDNA ORF Clone, Mouse;Gpr69a cDNA ORF Clone, Mouse;p40 cDNA ORF Clone, Mouse
LANCL1 Background Information
Full Name
LanC lantibiotic synthetase component C-like 1 (bacterial)

LANCL1 cDNA ORF Clone, Mouse, Related Products

Product Name Catalog#(PDF)
LANCL1 cDNA ORF Clone in Cloning Vector, Mouse MG52564-U
LANCL1 cDNA ORF Clone, Mouse, untagged MG52564-UT
LANCL1 cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52564-ACG
LANCL1 Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG52564-ACGLN
LANCL1 cDNA ORF Clone, Mouse, N-GFPSpark® tag MG52564-ANG
LANCL1 cDNA ORF Clone, Mouse, C-OFPSpark® tag MG52564-ACR
LANCL1 cDNA ORF Clone, Mouse, N-OFPSpark® tag MG52564-ANR
LANCL1 cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG52564-CF
LANCL1 cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG52564-NF
LANCL1 cDNA ORF Clone, Mouse, C-His tag MG52564-CH
LANCL1 cDNA ORF Clone, Mouse, C-HA tag MG52564-CY
LANCL1 cDNA ORF Clone, Mouse, N-HA tag MG52564-NY
LANCL1 cDNA ORF Clone, Mouse, C-Myc tag MG52564-CM
LANCL1 cDNA ORF Clone, Mouse, N-Myc tag MG52564-NM
LANCL1 qPCR Primer Pairs, Mouse MP202436

LANCL1 cDNA ORF Clone, Human, Related Products

Product Name Catalog#(PDF)
LANCL1 cDNA ORF Clone in Cloning Vector, Human HG14765-G
LANCL1 cDNA ORF Clone, Human, untagged HG14765-UT
LANCL1 Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG14765-ACGLN
LANCL1 cDNA ORF Clone, Human, C-GFPSpark® tag HG14765-ACG
LANCL1 cDNA ORF Clone, Human, N-GFPSpark® tag HG14765-ANG
LANCL1 cDNA ORF Clone, Human, C-OFPSpark® tag HG14765-ACR
LANCL1 cDNA ORF Clone, Human, N-OFPSpark® tag HG14765-ANR
LANCL1 cDNA ORF Clone, Human, C-DDK (Flag®) tag HG14765-CF
LANCL1 cDNA ORF Clone, Human, N-DDK (Flag®) tag HG14765-NF
LANCL1 cDNA ORF Clone, Human, C-His tag HG14765-CH
LANCL1 cDNA ORF Clone, Human, N-His tag HG14765-NH
LANCL1 cDNA ORF Clone, Human, C-HA tag HG14765-CY
LANCL1 cDNA ORF Clone, Human, N-HA tag HG14765-NY
LANCL1 cDNA ORF Clone, Human, C-Myc tag HG14765-CM
LANCL1 cDNA ORF Clone, Human, N-Myc tag HG14765-NM
LANCL1 qPCR Primer Pairs, Human HP103398
info info
添加购物车成功! 添加购物车失败!