L1CAM cDNA ORF Clone, Mouse, N-His tag

Cat: MG50835-NH
Contact us:
215-583-7898
order@sinobiological.com
Distributors
All L1CAM Reagents
CRO Services
Product recommended

All L1CAM Reagents
L1CAM cDNA ORF Clone, Mouse, N-His tag General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
3780 bp
Description
Full length Clone DNA of Mouse L1 cell adhesion molecule with N terminal His tag.
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-SP-N-His
Tag Sequence
His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Kanamycin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

L1CAM cDNA ORF Clone, Mouse, N-His tag Alternative Names
CD171 cDNA ORF Clone, Mouse;L1 cDNA ORF Clone, Mouse;N-CAM-L1 cDNA ORF Clone, Mouse;NCAM-L1 cDNA ORF Clone, Mouse
L1CAM Background Information

L1 cell adhesion molecule (L1CAM), also designated as CD171, is a cell adhesion receptor of the immunoglobulin superfamily, known for its roles in nerve cell function. While originally believed to be present only in brain cells, in recent years L1-CAM has been detected in other tissues, and in a variety of cancer cells, including some common types of human cancer. L1CAM interacts with a variety of ligands including axonin-1, CD9, neurocan and intergrins, and it has been revealed that the RGD motif in the sixth Ig domain of L1CAM is a binding site for integrins, thus important for nuclear signaling. Disruption of L1CAM function causes three X-linked neurological syndromes, i.e. hydrocephalus, MASA syndrome (mental retardation, aphasia, shuffling gait and adducted thumbs) and spastic paraplegia syndrome. Overexpression of L1CAM in normal and cancer cells increased motility, enhanced growth rate and promoted cell transformation and tumorigenicity. Recent work has identified L1CAM (CD171) as a novel marker for human carcinoma progression, and a candidate for anti-cancer therapy.

Full Name
L1 cell adhesion molecule
References
  • Meier F, et al. (2006) The adhesion molecule L1 (CD171) promotes melanoma progression. Int J Cancer. 119(3): 549-55.
  • Gavert N, et al. (2008) L1-CAM in cancerous tissues. Expert Opin Biol Ther. 8(11): 1749-57.
  • Issa Y, et al. (2009) Enhanced L1CAM expression on pancreatic tumor endothelium mediates selective tumor cell transmigration. J Mol Med. 87(1): 99-112.
  • Weidle UH, et al. (2009) L1-CAM as a target for treatment of cancer with monoclonal antibodies. Anticancer Res. 29(12): 4919-31.
  • Raveh S, et al. (2009) L1 cell adhesion molecule (L1CAM) in invasive tumors. Cancer Lett. 282(2): 137-45.
  • Wolterink S, et al. (2010) Therapeutic antibodies to human L1CAM: functional characterization and application in a mouse model for ovarian carcinoma. Cancer Res. 70(6): 2504-15.
  • L1CAM cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    L1CAM cDNA ORF Clone in Cloning Vector, Mouse MG50835-G
    L1CAM cDNA ORF Clone, Mouse, untagged MG50835-UT
    L1CAM Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50835-ACGLN
    L1CAM cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50835-ACG
    L1CAM cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50835-ACR
    L1CAM cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50835-CF
    L1CAM cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50835-NF
    L1CAM cDNA ORF Clone, Mouse, C-His tag MG50835-CH
    L1CAM cDNA ORF Clone, Mouse, C-HA tag MG50835-CY
    L1CAM cDNA ORF Clone, Mouse, C-HA tag MG50835-G-Y
    L1CAM cDNA ORF Clone, Mouse, N-HA tag MG50835-NY
    L1CAM cDNA ORF Clone, Mouse, C-Myc tag MG50835-CM
    L1CAM cDNA ORF Clone, Mouse, N-Myc tag MG50835-NM
    L1CAM qPCR Primer Pairs, Mouse MP200806

    L1CAM cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    L1CAM cDNA ORF Clone in Cloning Vector, Human HG10140-G
    L1CAM cDNA ORF Clone, Human, untagged HG10140-UT
    L1CAM Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10140-ACGLN
    L1CAM cDNA ORF Clone, Human, C-GFPSpark® tag HG10140-ACG
    L1CAM cDNA ORF Clone, Human, C-OFPSpark® tag HG10140-ACR
    L1CAM cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10140-CF
    L1CAM cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10140-NF
    L1CAM cDNA ORF Clone, Human, C-His tag HG10140-CH
    L1CAM cDNA ORF Clone, Human, N-His tag HG10140-NH
    L1CAM cDNA ORF Clone, Human, C-HA tag HG10140-CY
    L1CAM cDNA ORF Clone, Human, N-HA tag HG10140-NY
    L1CAM cDNA ORF Clone, Human, C-Myc tag HG10140-CM
    L1CAM cDNA ORF Clone, Human, N-Myc tag HG10140-NM
    L1CAM qPCR Primer Pairs, Human HP100211
    info info
    添加购物车成功! 添加购物车失败!