Quick Order

Mouse CD171/L1CAM Gene ORF cDNA clone expression plasmid, N-Myc tag

DatasheetReviewsRelated ProductsProtocols
Mouse L1CAM cDNA Clone Product Information
NCBI RefSeq:NM_008478.3
RefSeq ORF Size:3780bp
cDNA Description:Full length Clone DNA of Mus musculus L1 cell adhesion molecule with N terminal Myc tag.
Gene Synonym:L1, CD171, L1-NCAM, NCAM-L1, L1cam
Species:Mouse
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

L1 cell adhesion molecule (L1CAM), also designated as CD171, is a cell adhesion receptor of the immunoglobulin superfamily, known for its roles in nerve cell function. While originally believed to be present only in brain cells, in recent years L1-CAM has been detected in other tissues, and in a variety of cancer cells, including some common types of human cancer. L1CAM interacts with a variety of ligands including axonin-1, CD9, neurocan and intergrins, and it has been revealed that the RGD motif in the sixth Ig domain of L1CAM is a binding site for integrins, thus important for nuclear signaling. Disruption of L1CAM function causes three X-linked neurological syndromes, i.e. hydrocephalus, MASA syndrome (mental retardation, aphasia, shuffling gait and adducted thumbs) and spastic paraplegia syndrome. Overexpression of L1CAM in normal and cancer cells increased motility, enhanced growth rate and promoted cell transformation and tumorigenicity. Recent work has identified L1CAM (CD171) as a novel marker for human carcinoma progression, and a candidate for anti-cancer therapy.

References
  • Meier F, et al. (2006) The adhesion molecule L1 (CD171) promotes melanoma progression. Int J Cancer. 119(3): 549-55.
  • Gavert N, et al. (2008) L1-CAM in cancerous tissues. Expert Opin Biol Ther. 8(11): 1749-57.
  • Issa Y, et al. (2009) Enhanced L1CAM expression on pancreatic tumor endothelium mediates selective tumor cell transmigration. J Mol Med. 87(1): 99-112.
  • Weidle UH, et al. (2009) L1-CAM as a target for treatment of cancer with monoclonal antibodies. Anticancer Res. 29(12): 4919-31.
  • Raveh S, et al. (2009) L1 cell adhesion molecule (L1CAM) in invasive tumors. Cancer Lett. 282(2): 137-45.
  • Wolterink S, et al. (2010) Therapeutic antibodies to human L1CAM: functional characterization and application in a mouse model for ovarian carcinoma. Cancer Res. 70(6): 2504-15.
  • Size / Price
    Catalog: MG50835-NM
    List Price: 
    Price:      (You Save: )
    Size:
    Quantity:+-
    Availability2-3 weeks
    Bulk Discount InquiryAdd to Cart
    Contact Us
    Images
        All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"