kynureninase cDNA ORF Clone, Mouse, untagged

Cat: MG50310-UT
Contact us:
+86-400-890-9989
order@sinobiological.com
Distributors
All kynureninase Reagents
CRO Services
Product recommended

All kynureninase Reagents
kynureninase cDNA ORF Clone, Mouse, untagged General Information
Gene
Species
Mouse
NCBI Ref Seq
RefSeq ORF Size
1398 bp
Description
Full length Clone DNA of Mouse kynureninase (L-kynurenine hydrolase).
Plasmid
Promoter
Enhanced CMV promoter
Vector
pCMV3-untagged
Sequencing Primers
T7( 5' TAATACGACTCACTATAGGG 3' )
BGH( 5' TAGAAGGCACAGTCGAGG 3' )
Quality Control
The plasmid is confirmed by full-length sequencing.
Screening
Antibiotic in E.coli
Ampicillin
Antibiotic in Mammalian cell
Hygromycin
Application
Stable or Transient mammalian expression
Storage & Shipping
Shipping
Each tube contains lyophilized plasmid.
Storage
The lyophilized plasmid can be stored at ambient temperature for three months.

**Sino Biological guarantees 100% sequence accuracy of all synthetic DNA constructs we deliver, but we do not guarantee protein expression in your experimental system. Protein expression is influenced by many factors that may vary between experiments or laboratories.**

kynureninase cDNA ORF Clone, Mouse, untagged Alternative Names
4432411A05Rik cDNA ORF Clone, Mouse
kynureninase Background Information
Full Name
kynureninase
References
  • Lima S, et al. (2007) Crystal structure of Homo sapiens kynureninase. Biochemistry. 46(10): 2735-44.
  • Momany C, et al. (2004) Three-dimensional structure of kynureninase from Pseudomonas fluorescens. Biochemistry. 43(5): 1193-203.
  • Toma S, et al. (1997) Cloning and recombinant expression of rat and human kynureninase. FEBS Lett. 408(1): 5-10.
  • kynureninase cDNA ORF Clone, Mouse, Related Products

    Product Name Catalog#(PDF)
    kynureninase cDNA ORF Clone in Cloning Vector, Mouse MG50310-M
    kynureninase cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50310-ACG
    kynureninase Lentiviral cDNA ORF Clone, Mouse, C-GFPSpark® tag MG50310-ACGLN
    kynureninase cDNA ORF Clone, Mouse, N-GFPSpark® tag MG50310-ANG
    kynureninase cDNA ORF Clone, Mouse, C-OFPSpark® tag MG50310-ACR
    kynureninase cDNA ORF Clone, Mouse, N-OFPSpark® tag MG50310-ANR
    kynureninase cDNA ORF Clone, Mouse, C-DDK (Flag®) tag MG50310-CF
    kynureninase cDNA ORF Clone, Mouse, N-DDK (Flag®) tag MG50310-NF
    kynureninase cDNA ORF Clone, Mouse, C-His tag MG50310-CH
    kynureninase cDNA ORF Clone, Mouse, N-His tag MG50310-NH
    kynureninase cDNA ORF Clone, Mouse, C-HA tag MG50310-CY
    kynureninase cDNA ORF Clone, Mouse, N-HA tag MG50310-NY
    kynureninase cDNA ORF Clone, Mouse, C-Myc tag MG50310-CM
    kynureninase cDNA ORF Clone, Mouse, N-Myc tag MG50310-NM
    kynureninase qPCR Primer Pairs, Mouse MP200333

    kynureninase cDNA ORF Clone, Human, Related Products

    Product Name Catalog#(PDF)
    kynureninase cDNA ORF Clone in Cloning Vector, Human HG10841-M
    kynureninase cDNA ORF Clone, Human, untagged HG10841-UT
    kynureninase cDNA ORF Clone, Human, C-GFPSpark® tag HG10841-ACG
    kynureninase Lentiviral cDNA ORF Clone, Human, C-GFPSpark® tag HG10841-ACGLN
    kynureninase cDNA ORF Clone, Human, N-GFPSpark® tag HG10841-ANG
    kynureninase cDNA ORF Clone, Human, C-OFPSpark® tag HG10841-ACR
    kynureninase cDNA ORF Clone, Human, N-OFPSpark® tag HG10841-ANR
    kynureninase cDNA ORF Clone, Human, C-DDK (Flag®) tag HG10841-CF
    kynureninase cDNA ORF Clone, Human, N-DDK (Flag®) tag HG10841-NF
    kynureninase cDNA ORF Clone, Human, C-His tag HG10841-CH
    kynureninase cDNA ORF Clone, Human, N-His tag HG10841-NH
    kynureninase cDNA ORF Clone, Human, C-HA tag HG10841-CY
    kynureninase cDNA ORF Clone, Human, N-HA tag HG10841-NY
    kynureninase cDNA ORF Clone, Human, C-Myc tag HG10841-CM
    kynureninase cDNA ORF Clone, Human, N-Myc tag HG10841-NM
    kynureninase qPCR Primer Pairs, Human HP100921
    info info
    添加购物车成功! 添加购物车失败!